ID: 1071823001 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:89297129-89297151 |
| Sequence | GTGGCCAGCTTGGCTGAGAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1071822998_1071823001 | 4 | Left | 1071822998 | 10:89297102-89297124 | CCAAGGCGCAGAAGAAGAAGGTA | 0: 1 1: 0 2: 0 3: 12 4: 182 |
||
| Right | 1071823001 | 10:89297129-89297151 | GTGGCCAGCTTGGCTGAGATTGG | No data | ||||
| 1071822997_1071823001 | 5 | Left | 1071822997 | 10:89297101-89297123 | CCCAAGGCGCAGAAGAAGAAGGT | 0: 1 1: 0 2: 0 3: 15 4: 175 |
||
| Right | 1071823001 | 10:89297129-89297151 | GTGGCCAGCTTGGCTGAGATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1071823001 | Original CRISPR | GTGGCCAGCTTGGCTGAGAT TGG | Intronic | ||
| No off target data available for this crispr | |||||