ID: 1071823001

View in Genome Browser
Species Human (GRCh38)
Location 10:89297129-89297151
Sequence GTGGCCAGCTTGGCTGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071822998_1071823001 4 Left 1071822998 10:89297102-89297124 CCAAGGCGCAGAAGAAGAAGGTA 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1071823001 10:89297129-89297151 GTGGCCAGCTTGGCTGAGATTGG No data
1071822997_1071823001 5 Left 1071822997 10:89297101-89297123 CCCAAGGCGCAGAAGAAGAAGGT 0: 1
1: 0
2: 0
3: 15
4: 175
Right 1071823001 10:89297129-89297151 GTGGCCAGCTTGGCTGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071823001 Original CRISPR GTGGCCAGCTTGGCTGAGAT TGG Intronic
No off target data available for this crispr