ID: 1071823986

View in Genome Browser
Species Human (GRCh38)
Location 10:89306243-89306265
Sequence GACCCAGGCATAGTTTCCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 6, 3: 15, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071823986_1071823987 -10 Left 1071823986 10:89306243-89306265 CCTGGGGAAACTATGCCTGGGTC 0: 1
1: 0
2: 6
3: 15
4: 127
Right 1071823987 10:89306256-89306278 TGCCTGGGTCTACTATCACATGG 0: 1
1: 0
2: 2
3: 9
4: 102
1071823986_1071823988 -9 Left 1071823986 10:89306243-89306265 CCTGGGGAAACTATGCCTGGGTC 0: 1
1: 0
2: 6
3: 15
4: 127
Right 1071823988 10:89306257-89306279 GCCTGGGTCTACTATCACATGGG 0: 1
1: 1
2: 0
3: 6
4: 79
1071823986_1071823991 26 Left 1071823986 10:89306243-89306265 CCTGGGGAAACTATGCCTGGGTC 0: 1
1: 0
2: 6
3: 15
4: 127
Right 1071823991 10:89306292-89306314 CGTTCAGATTTATGTAGACAAGG 0: 1
1: 0
2: 1
3: 8
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071823986 Original CRISPR GACCCAGGCATAGTTTCCCC AGG (reversed) Exonic
900387362 1:2416704-2416726 GGCCCAGGCACTGTTTCCCACGG - Intergenic
913112156 1:115666387-115666409 GCCACAGGCATACTTTCCTCGGG - Intronic
916678678 1:167085395-167085417 GGGCCAGGCACACTTTCCCCAGG + Intronic
1067298968 10:44992524-44992546 GACCCTGGCGTGGTGTCCCCAGG - Intronic
1070597704 10:77844325-77844347 AACTCAGGCCCAGTTTCCCCTGG + Intronic
1071499506 10:86193447-86193469 GACCCTGGCATGGTTTCCTCAGG - Intronic
1071823986 10:89306243-89306265 GACCCAGGCATAGTTTCCCCAGG - Exonic
1071830042 10:89362576-89362598 AGCCCAGGCAAAGTTGCCCCAGG - Intronic
1071832271 10:89383603-89383625 CACCCAGGCAAAGTTGCCCCAGG - Exonic
1071834103 10:89402565-89402587 CATCCAGGCAAAGTTGCCCCAGG - Exonic
1075461635 10:122620428-122620450 GACCCAGGACTAGGTTCCCAGGG - Intronic
1077018763 11:408206-408228 GACCCTGGCTTGGTATCCCCAGG - Exonic
1078049019 11:7945750-7945772 GGCCCAGGCACCATTTCCCCAGG + Intergenic
1084215644 11:67645573-67645595 TCCCCGGGCCTAGTTTCCCCTGG - Intronic
1084303279 11:68265063-68265085 GGCCCAGGCATCGCTTTCCCAGG - Intronic
1088571094 11:111223537-111223559 GCACCAGGCATGGTTTCCCTTGG - Intergenic
1091044079 11:132310274-132310296 GACCCTGGAAAAGTTTCTCCTGG - Intronic
1092241189 12:6837497-6837519 GACCCAGGCCTACTTCTCCCCGG + Exonic
1096799189 12:54098224-54098246 GCCCCAGGCATTATTTCCCCAGG + Intergenic
1100881618 12:99024815-99024837 GACACAAGCATATTTTTCCCTGG - Intronic
1102819903 12:115899198-115899220 TATCCAGGCATGGTTTCTCCAGG - Intergenic
1103827800 12:123753965-123753987 GCCCCTTGCATAGTTTTCCCTGG + Intronic
1104765672 12:131328420-131328442 TCTCCAGGCATAGTTACCCCTGG - Intergenic
1104813599 12:131633440-131633462 TCTCCAGGCATAGTTACCCCTGG + Intergenic
1104813618 12:131633506-131633528 TCTCCAGGCATAGTTACCCCTGG + Intergenic
1104813634 12:131633571-131633593 TCTCCAGGCATAGTTACCCCTGG + Intergenic
1104813654 12:131633637-131633659 TCTCCAGGCATAGTTACCCCTGG + Intergenic
1106715617 13:32384950-32384972 CACCCAGGCAAAGTTGCCCCAGG - Intronic
1107253308 13:38392190-38392212 GAGGCAGCCATAATTTCCCCTGG - Intergenic
1109212312 13:59548408-59548430 GGCCCAGGCACTGTTTCCCTGGG - Intergenic
1111180690 13:84660349-84660371 AACCCAGGAATAGTGGCCCCTGG - Intergenic
1113401966 13:110002465-110002487 ATCCCAGGCATCGTTTCCTCGGG - Intergenic
1114141484 14:19916220-19916242 GGCCCAGGCTGAGTTTTCCCTGG - Intergenic
1115556278 14:34547183-34547205 GACCCTGGGATATTTTCCCCAGG - Intergenic
1115557630 14:34555898-34555920 GACCCTGGGATATTTTCCCCAGG + Intergenic
1117339268 14:54780006-54780028 GACCCAGGCTTAGTTGTCCTTGG + Intronic
1119091326 14:71783925-71783947 ACCCCAAGCATAGTTTACCCAGG - Intergenic
1120337463 14:83175018-83175040 TACCAAAGCATAGTTTCACCAGG - Intergenic
1121279484 14:92688625-92688647 GGCCCGAGCTTAGTTTCCCCAGG + Exonic
1121756651 14:96408361-96408383 AACCGAGGCACAGTTTGCCCAGG - Intronic
1127705666 15:61545164-61545186 AACCCAGGCATAGTTCAACCAGG - Intergenic
1127820060 15:62646882-62646904 GACCCAGTCATAGGTGCCCAAGG + Intronic
1128450859 15:67805215-67805237 GACCCACGCAGGGTGTCCCCAGG + Intronic
1130686238 15:86040229-86040251 CACACAGACATCGTTTCCCCAGG - Intergenic
1134610094 16:15601229-15601251 GACCCAGGCAAAGCTTGCCTGGG - Intronic
1136429016 16:30186344-30186366 GACCCTGGCAGAGTTCCCGCCGG - Intronic
1136593106 16:31229557-31229579 GACCCAGGCAGGGTCTCCCTGGG + Intergenic
1141779584 16:86150723-86150745 GACCGAGGCACAGCTTCCCAAGG - Intergenic
1142810022 17:2391491-2391513 GACCCCTGCAAGGTTTCCCCAGG + Intronic
1147544996 17:41394239-41394261 GACCCAGGCATTCTTACCCTTGG - Intronic
1148471577 17:47896640-47896662 GACCCAGGCATAGTTCGCCCAGG - Intronic
1151151953 17:72095810-72095832 GAGGCAGGCATAGCTTTCCCTGG - Intergenic
1151349232 17:73521871-73521893 CAGCCAGGCAAAGTGTCCCCGGG - Intronic
1151378155 17:73705791-73705813 GACACAGGCAGACTTTCCCCAGG - Intergenic
1152938900 17:83155346-83155368 GTCCCAGGCAGAGGTTCCTCCGG + Intergenic
1154035304 18:10795727-10795749 AACCTAGGCACGGTTTCCCCAGG - Intronic
1163656212 19:18546597-18546619 TACCCAGGCTTAGGTTGCCCAGG - Intergenic
1164776605 19:30858075-30858097 GACCTGGGCATATTATCCCCGGG + Intergenic
928641847 2:33307259-33307281 GACCCATGCATCGTTTTCCTGGG + Intronic
929533261 2:42765144-42765166 GTCCCAGGCACAGTGGCCCCTGG + Intergenic
929658116 2:43754704-43754726 GACCAAGGCTTAGATTCCCCAGG + Intronic
933170676 2:79121569-79121591 GGCCCAGACAGAGTTGCCCCAGG + Exonic
933907388 2:86908649-86908671 GACCCAGGCAAAGTTGTCCTGGG - Intronic
933908636 2:86918338-86918360 GACCCAGGCAAAGTTGTCCTGGG - Intronic
934024087 2:87985045-87985067 GACCCAGGCAAAGTTGTCCTGGG + Intergenic
934742634 2:96736307-96736329 GACCCAGGCATTGATTCCAATGG + Intronic
935624431 2:105158758-105158780 GACCCAGGTATAGTTTATCTTGG - Intergenic
936364734 2:111842757-111842779 GACCCAGGCAAAGTTGTCCTGGG + Intronic
938228763 2:129639870-129639892 GTCCTATGCATAGTCTCCCCTGG + Intergenic
939200761 2:139031234-139031256 GGCCCAGGCATGGTTTCCCTGGG + Intergenic
942066218 2:172274254-172274276 GCCCCAGGAATGGTTTCCACAGG + Intergenic
946392871 2:219426835-219426857 TACCCAGCCAGACTTTCCCCAGG + Intergenic
947241146 2:227995799-227995821 GACACAGGCAGAGTCTCCCTGGG + Intronic
947841147 2:233208692-233208714 GACCCAGGCATGGATGCCCATGG + Intergenic
1171197626 20:23212684-23212706 GCCCCAGGCATTTGTTCCCCAGG - Intergenic
1171797233 20:29576122-29576144 GCCCCAGGCATTATTTCCCCGGG - Intergenic
1171851019 20:30308039-30308061 GCCCCAGGCATTATTTCCCCAGG + Intergenic
1172242676 20:33423633-33423655 GAGCCAGGAATAGATTCCACTGG + Intronic
1172602054 20:36190691-36190713 GACCCAGGCACAGACTCGCCAGG + Exonic
1174451203 20:50621615-50621637 GTCCCAGGTATATGTTCCCCAGG - Intronic
1174636384 20:52004032-52004054 CACTGAGGCATAGTTCCCCCTGG - Intergenic
1175263134 20:57687260-57687282 GCCCCAGGCACAGGTGCCCCAGG - Intronic
1176117876 20:63440897-63440919 GGCCCTGGCTTAGTCTCCCCAGG - Intronic
1178207217 21:30483178-30483200 GTCCCAGGGATAGTTTCCATGGG - Intronic
1181316714 22:21975267-21975289 GCCCCAGGCATTGTCACCCCTGG - Intronic
1181716523 22:24734522-24734544 GACCCAGGAACTGTTTCCCTGGG - Intronic
1181884668 22:26010738-26010760 CACCCAGTCCTAGTTTTCCCTGG - Intronic
1182566236 22:31202135-31202157 GACCTAGGCATGGTTCCCACAGG - Intronic
1183101691 22:35588063-35588085 GACCCAGGCATCCTGTGCCCAGG - Intergenic
1185203547 22:49523332-49523354 GACCCAGACTTTGTATCCCCTGG + Intronic
949681546 3:6519984-6520006 GGCCCAGGCAGAGTTGCCACAGG - Intergenic
960375320 3:116893264-116893286 AACCCAGGCAGAGAATCCCCAGG - Intronic
961773745 3:129269030-129269052 GACCTGGGCTTAGTTTCCTCAGG + Intronic
966871276 3:184291834-184291856 GACCCAGGCAGAGCCTCCGCTGG + Intronic
968024957 3:195433782-195433804 GACCAAGTCATAGTTATCCCAGG - Intronic
973924670 4:55725235-55725257 GGTCCATGCATAGTTTGCCCTGG + Intergenic
977684583 4:99834057-99834079 GACCCAGGCAAAGCAACCCCCGG + Intronic
982017127 4:151165791-151165813 TATCCATGAATAGTTTCCCCAGG - Intronic
984278920 4:177643741-177643763 TACCCAGGTCTATTTTCCCCTGG + Intergenic
984456753 4:179978585-179978607 GACCTAAGCATATTTTCCACAGG + Intergenic
985970665 5:3375744-3375766 GAACCAGGGATAAATTCCCCAGG + Intergenic
991440474 5:66642270-66642292 GTCCTATGCACAGTTTCCCCTGG - Intronic
994152289 5:96461609-96461631 GACCCAGGCATGTTTTACCTCGG - Intergenic
997226606 5:132213927-132213949 GACCCAGGCACAATTTCCAGAGG - Exonic
998062847 5:139132770-139132792 GTGGCAGGCATAGTTTGCCCTGG + Intronic
998894086 5:146779512-146779534 TACCGAGGTGTAGTTTCCCCAGG + Intronic
999772346 5:154785154-154785176 GCCCCAGGGCAAGTTTCCCCAGG - Intronic
1000130460 5:158292101-158292123 GGCCAAGCCAAAGTTTCCCCAGG + Intergenic
1001527692 5:172440408-172440430 GATCCAGGCACAGCATCCCCAGG - Intronic
1002870991 6:1167125-1167147 GACCGAGCCATTGTTTCCCTTGG + Intergenic
1002881334 6:1255050-1255072 GACCCAAGCATAGTTTCAGAAGG - Intergenic
1004534509 6:16487064-16487086 GACCCAGGAACAGCTTCTCCTGG + Intronic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1007960774 6:45957044-45957066 GACACAGGAAGAATTTCCCCAGG + Intronic
1008087293 6:47258462-47258484 GACACTGGAACAGTTTCCCCAGG + Intronic
1008537163 6:52515201-52515223 GACCCAGGCATGGATTTCTCAGG + Intronic
1008547010 6:52592002-52592024 GAGCCAAGCATGGTTACCCCAGG + Intergenic
1014504400 6:122235906-122235928 TAGCCAGGCATAGTTTCTCATGG + Intergenic
1018829492 6:167432390-167432412 CACCCAGGCATAGATACCTCAGG - Intergenic
1020020743 7:4866683-4866705 GACCCAGGATAAGTCTCCCCTGG - Intronic
1021538681 7:21733007-21733029 GAGCCAGGCAGAGCTTCCCGTGG + Intronic
1026554012 7:71390663-71390685 CACCCCTGCATATTTTCCCCAGG + Intronic
1027187228 7:75979782-75979804 GTGCCAGGCATCGTTTCCCCAGG + Intronic
1027838771 7:83279886-83279908 GACCAAGGAATGGTTTCCCTCGG + Intergenic
1029474523 7:100775251-100775273 AACCCAGGACTAGTTTCCCAGGG + Intronic
1033268555 7:139910183-139910205 GACCCAGTCACAGTTTCCAAGGG - Intronic
1035674001 8:1442230-1442252 GACCCAGGCATAGACCCGCCAGG + Intergenic
1037439776 8:18903727-18903749 GGCCCAGGCACAGTTTCCCTAGG + Intronic
1037884240 8:22588052-22588074 GACCTAGAGATAGTTTCCGCAGG - Intronic
1040611118 8:48983127-48983149 CACCCAGGCATCCTTTGCCCCGG - Intergenic
1040934245 8:52766498-52766520 TACCCAGGCAGATTTCCCCCAGG - Intergenic
1047255626 8:123211528-123211550 GACCCAGGCATTGCTTCCTAGGG + Intergenic
1047501236 8:125443350-125443372 GTCTCAGCCTTAGTTTCCCCTGG - Intergenic
1048823624 8:138401892-138401914 AACTCAGGCATGGTTTTCCCAGG + Intronic
1049581446 8:143412943-143412965 GTCCCAGGCCCAGTTTCCCCAGG - Intergenic
1050998926 9:12256480-12256502 CACCAAGGCACACTTTCCCCAGG + Intergenic
1051533579 9:18132187-18132209 GACTCAGGCCTTTTTTCCCCGGG - Intergenic
1053788793 9:41671320-41671342 GACCCAGGCATTATTTCCCCAGG + Intergenic
1054156347 9:61643448-61643470 GACCCAGGCATTATTTCCCCAGG - Intergenic
1054177074 9:61882659-61882681 GACCCAGGCATTATTTCCCCAGG + Intergenic
1054476119 9:65574458-65574480 GACCCAGGCATTATTTCCCCAGG - Intergenic
1054660460 9:67698147-67698169 GACCCAGGCATTATTTCCCCAGG - Intergenic
1056823244 9:89859377-89859399 GACGCAGGTATAGGTGCCCCAGG + Intergenic
1061039712 9:128132906-128132928 GACGCAGGTATAGGTGCCCCAGG - Intergenic
1190218284 X:48494335-48494357 GAGCCAGGCATACCTTCACCCGG + Intergenic
1191718509 X:64209590-64209612 GACCCAGACTCAGTTTCCCAGGG + Intergenic
1192131074 X:68551045-68551067 GACCCAGGCAAAATTGCACCTGG - Intergenic
1198413390 X:136394395-136394417 GTTCCAGGCAGAGTTTCCACAGG - Intronic
1199431047 X:147760484-147760506 GACAGAGGAATAGTTTGCCCAGG + Intergenic