ID: 1071826662

View in Genome Browser
Species Human (GRCh38)
Location 10:89332205-89332227
Sequence GCTCTTTGACCTGTGTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071826662 Original CRISPR GCTCTTTGACCTGTGTGGTG AGG (reversed) Intronic
900294373 1:1941522-1941544 GCTCCTTTACCTGTGTCTTGAGG - Intronic
901535724 1:9881914-9881936 TCTCTTTGCCTTGTGTTGTGTGG - Intronic
903145453 1:21369143-21369165 GCTCACTTACCTGTGTTGTGGGG + Intergenic
904277570 1:29394423-29394445 GCTCTGTGACCTGTGGGATGGGG + Intergenic
904914074 1:33957071-33957093 CCTCTTTGATTTGTGTGGTGAGG - Intronic
905254899 1:36674216-36674238 GCTCTTTGACCAGTGGTTTGGGG + Intergenic
906649592 1:47503225-47503247 GCTCTTTGGGCTGGGTGGCGTGG - Intergenic
906674518 1:47683543-47683565 GCTCTTTGACCTGGGTGTGCAGG - Intergenic
907705511 1:56829031-56829053 GCGCTTTGAATTGTGTGCTGAGG + Intergenic
909242713 1:73235626-73235648 GCACTTTGGCCTGTATGGTATGG + Intergenic
913464082 1:119121327-119121349 GCTCTTTCACCTCTTTGGTTAGG - Intronic
913584158 1:120256908-120256930 GCTCTGTCAGCTGTGTGCTGGGG + Intergenic
913624022 1:120641432-120641454 GCTCTGTCAGCTGTGTGCTGGGG - Intergenic
914194568 1:145438903-145438925 TCTCTTTAAGCAGTGTGGTGGGG + Intergenic
914475901 1:148021785-148021807 TCTCTTTAAGCAGTGTGGTGGGG + Intergenic
914566149 1:148868776-148868798 GCTCTGTCAGCTGTGTGCTGGGG + Intronic
914606672 1:149261464-149261486 GCTCTGTCAGCTGTGTGCTGGGG - Intergenic
915575951 1:156777187-156777209 GCTCTCTCAGCTGTGTCGTGTGG + Intronic
915745215 1:158150818-158150840 GGTCTGTGAGCTCTGTGGTGGGG + Intergenic
917135411 1:171784249-171784271 GATCTTTGAGCTGTGTGCTCAGG + Exonic
918055926 1:181022386-181022408 CCTTTTTGGCCTGTGTGCTGCGG - Intronic
918701192 1:187610214-187610236 GCTCTTTCACTTCTCTGGTGAGG - Intergenic
918860940 1:189825759-189825781 GCTATGTGGCCTGTGGGGTGGGG + Intergenic
922064511 1:222124178-222124200 GCTATTTGACTTCTGTGATGTGG - Intergenic
922229570 1:223674047-223674069 GCCCTTTCACCAGTGTGGTCTGG - Intergenic
922415913 1:225423294-225423316 GCTTTTCAACCTGTCTGGTGAGG - Intronic
1064899183 10:20275264-20275286 GCTCTTCGAAATGTGTTGTGTGG + Intronic
1065606827 10:27426923-27426945 GTTCCTTGACCTGTGGAGTGAGG + Intergenic
1067088341 10:43254346-43254368 CCCCTTAGATCTGTGTGGTGGGG + Intronic
1067263544 10:44715568-44715590 GCTTGCTGACCTGAGTGGTGCGG - Intergenic
1067523537 10:47025516-47025538 GCTCCCTCCCCTGTGTGGTGCGG + Intergenic
1067778497 10:49179869-49179891 GCTGTTTGACCGTTGTGGAGTGG - Intronic
1067961352 10:50854520-50854542 GCTCTTTGACCTGAGGAATGAGG - Intronic
1068116990 10:52746549-52746571 GCTCTTAGGCCTGTCAGGTGGGG - Intergenic
1069139314 10:64803748-64803770 GCTCTCTGATCTGTGTAGTTAGG - Intergenic
1071826662 10:89332205-89332227 GCTCTTTGACCTGTGTGGTGAGG - Intronic
1072098266 10:92204193-92204215 GCTGTTTGACTTGGGTGGTTGGG + Intronic
1072520055 10:96223309-96223331 GCTGTTTGACCTTTGAGTTGGGG - Intronic
1073625951 10:105097080-105097102 GCTTTTTCAGTTGTGTGGTGTGG + Intronic
1074632632 10:115275136-115275158 GTTCCTTGACCTGTGGAGTGAGG - Intronic
1077162836 11:1121476-1121498 CCTCTTTGGCCTCTGTGGTTTGG - Intergenic
1080746379 11:35111867-35111889 GCTCTGAGACCTGTGGGATGTGG - Intergenic
1086917546 11:92547938-92547960 GCTCCTGGCCCTGTGTGGAGAGG + Intronic
1087347473 11:96990153-96990175 GCTCCTTGACCTGTGGAGTGAGG + Intergenic
1091613884 12:2034585-2034607 TCTCTTTGAGCTGTGTGCTGGGG - Intronic
1092526092 12:9311161-9311183 CCTCTGTAACCTGTGCGGTGTGG + Intergenic
1092541190 12:9420622-9420644 CCTCTGTAACCTGTGCGGTGTGG - Intergenic
1093868789 12:24261510-24261532 GATTTTTCTCCTGTGTGGTGTGG - Intergenic
1094034618 12:26054607-26054629 ACTCTTTGTCCTGTGGGGAGAGG + Intronic
1094258939 12:28469371-28469393 GCTCTTTCACTTGTTTGGTTAGG - Intronic
1094511852 12:31101853-31101875 TCTCTGTAACCTGTGCGGTGTGG + Exonic
1097454231 12:59776721-59776743 GCTCTAAGACCTAGGTGGTGTGG + Intronic
1098158244 12:67622549-67622571 GTTCCTTGACCTGTGGAGTGAGG + Intergenic
1098797884 12:74915819-74915841 CCTCTTTGGCCTGTGTGGTCAGG - Intergenic
1101738045 12:107478111-107478133 TCTCTCTGAACTGTGTGTTGAGG - Intronic
1103830024 12:123771708-123771730 GCTCTTTGTCCTTGTTGGTGGGG + Intronic
1104349634 12:128033799-128033821 GCCTATGGACCTGTGTGGTGTGG + Intergenic
1109335667 13:60990813-60990835 CCTCTTCTTCCTGTGTGGTGGGG + Intergenic
1112486617 13:99825934-99825956 GCCCTTTGTCCAGTGGGGTGAGG - Intronic
1113563232 13:111300876-111300898 GATGTTTGACCTCTGCGGTGGGG + Intronic
1113567799 13:111329163-111329185 GCTCTTTGTGCTGCGTGGGGAGG + Intronic
1113866898 13:113532405-113532427 GCTCTGTGGCCTGTGTGGGTGGG + Intronic
1119760070 14:77144219-77144241 GGTCTTTGAAATGTCTGGTGAGG + Intronic
1120405424 14:84089085-84089107 GCTCTTTTACCTTTGAGGTGTGG - Intergenic
1120710527 14:87788716-87788738 GTTCCTTGACCTGTGGAGTGAGG - Intergenic
1121545395 14:94759468-94759490 GGTCTAAGGCCTGTGTGGTGAGG - Intergenic
1121718990 14:96096188-96096210 ACTCTCTGTCTTGTGTGGTGGGG + Intergenic
1122259121 14:100502069-100502091 GCTCTTTGGGCTGTTTGATGGGG + Intronic
1122285642 14:100650685-100650707 GCTCTGTGACCCATGTGGTGAGG - Intergenic
1122304553 14:100753874-100753896 TCTCTCTGAACTCTGTGGTGTGG + Intergenic
1122318921 14:100841619-100841641 CCTGTGTGACCTGTGTGGTCGGG + Intergenic
1122921878 14:104883689-104883711 CTTCTTTGCCCTGTGTGGGGGGG + Intronic
1124221481 15:27853712-27853734 GCTCTCTGAGGTGTCTGGTGGGG - Intronic
1124509484 15:30311014-30311036 GTTCTCTGACCTGTGGAGTGAGG + Intergenic
1124734075 15:32227648-32227670 GTTCTCTGACCTGTGGAGTGAGG - Intergenic
1128242744 15:66112370-66112392 GCTAATTAACCTGTCTGGTGTGG - Intronic
1130623551 15:85489510-85489532 GCTCATTGAGCAGGGTGGTGGGG + Intronic
1132244626 15:100284860-100284882 GCACTTTGACCTCTCTGGTGAGG - Intronic
1132372359 15:101307650-101307672 GCTCTGGGAGCCGTGTGGTGGGG - Intronic
1133823122 16:9254448-9254470 GCTCTTTTGCTTGTGTGCTGTGG + Intergenic
1135625876 16:23994392-23994414 GTTCTTTGACCTGTAGAGTGAGG + Intronic
1137287263 16:47026749-47026771 GCTGTGTGGCCTGTGTGGTGTGG - Intergenic
1137467994 16:48728653-48728675 GCTCTGTTTCCTGTGTGGAGCGG + Intergenic
1138224502 16:55281091-55281113 GGTCTTTGAACTGTGTTGTTTGG - Intergenic
1138267222 16:55668317-55668339 GATCTTTGATCTTTGTGGTGAGG + Intronic
1139824308 16:69745128-69745150 TCTTTGTGACATGTGTGGTGCGG - Intronic
1142765923 17:2064321-2064343 TGTCATTGACCTGTGGGGTGAGG + Intronic
1144162839 17:12578456-12578478 ACACTTGGCCCTGTGTGGTGTGG + Intergenic
1148336678 17:46846750-46846772 ACTCTTTGAATTGTGTTGTGAGG - Intronic
1149439345 17:56661991-56662013 GCTCCTGGCCCTGGGTGGTGAGG - Intergenic
1150917462 17:69451339-69451361 GCTCTTTGGTTTGTGGGGTGGGG - Intronic
1152005271 17:77676514-77676536 CCTCCCTGACCTGTGGGGTGAGG + Intergenic
1153245035 18:3065441-3065463 GCTTTTTGAGGGGTGTGGTGGGG + Intergenic
1157204564 18:45687528-45687550 CCTCTTTGAACTGTCTGGTGGGG + Intergenic
1157291051 18:46410069-46410091 GCTGTTTTACTTATGTGGTGAGG + Intronic
1160092312 18:75838914-75838936 GCTCTTTGACCAGTAGGGTAAGG + Intergenic
1161064073 19:2228980-2229002 GCTCTGTGCCCTGCGTGTTGAGG + Intronic
1161354232 19:3810273-3810295 GCTCTGTGAACCTTGTGGTGAGG + Intronic
1168242683 19:55095349-55095371 GCTCCTTGGCCTGTGTGGAGAGG + Exonic
1168356365 19:55702593-55702615 TTTCTTTGAACTGCGTGGTGTGG + Intronic
925557197 2:5144378-5144400 GCTCCTCGGCCTGTGTGCTGGGG - Intergenic
930270775 2:49253888-49253910 GCTCTTTGACTAGTGTTGTCAGG + Intergenic
932602631 2:73139033-73139055 TCTCTTTGACCTCTGGGGAGGGG - Intronic
933006108 2:76997694-76997716 GCTCTGTGACCTGGGAGTTGGGG - Intronic
933937301 2:87217100-87217122 GCTCATTGCCCTGGGAGGTGTGG + Intergenic
933937314 2:87217166-87217188 GCTCATTGCCCTGGGAGGTGTGG + Intergenic
934884504 2:98012707-98012729 TCTCTCTGGCCTGTGTGGAGAGG - Intergenic
934937712 2:98477327-98477349 GCTCTTTGTCCTGAATGGTGTGG + Intronic
936080584 2:109429977-109429999 GCTCAGTGGCCTGTGTGGGGTGG - Intronic
936152396 2:110028922-110028944 GCTTTTTGATCTGTAAGGTGTGG - Intergenic
936192283 2:110342490-110342512 GCTTTTTGATCTGTAAGGTGTGG + Intergenic
936355826 2:111748636-111748658 GCTCATTGCCCTGGGAGGTGTGG - Intergenic
936355841 2:111748724-111748746 GCTCATTGCCCTGGGAGGTGTGG - Intergenic
937663897 2:124462857-124462879 GAACTTTGACCTGTGGGGTATGG - Intronic
940261613 2:151785659-151785681 GCTCTTTCACCTCTGTATTGTGG - Intergenic
946576179 2:221078020-221078042 GTTCTTTCACCTGTATGGTGAGG + Intergenic
947178207 2:227388579-227388601 GCTCTGGGTCCTGAGTGGTGGGG - Intergenic
948730475 2:239960654-239960676 GCTCTGGGCCCTGTTTGGTGTGG - Exonic
1169531451 20:6489604-6489626 GCTCTTTGTCCTGTTTTGCGGGG - Intergenic
1171185307 20:23120479-23120501 GCCCCTTGCCCTGTGTGGTGTGG + Intergenic
1171358321 20:24567553-24567575 GGGCTCTGACCTGTGTGATGTGG + Intronic
1172032863 20:31993992-31994014 GCTCTGTGACCTGTGCAGAGTGG + Intronic
1173976211 20:47188509-47188531 GCTCTTGTACCTGTGTGGCTGGG + Exonic
1174359821 20:50021510-50021532 ATTCTTTGACTTGTGTGGTTTGG + Intergenic
1176027028 20:62990970-62990992 GCTGGCTGACCTGTGGGGTGGGG + Intergenic
1177687309 21:24454164-24454186 GATCTTTGAACTGTATGATGTGG + Intergenic
1178184524 21:30204982-30205004 TCTCTGTGACCTTTGTGGAGAGG - Intergenic
1179010215 21:37550885-37550907 GCTCACTGCCCTGTGTGTTGGGG + Intergenic
1180021558 21:45131628-45131650 GCTCTGTGCACAGTGTGGTGTGG + Intronic
1182331388 22:29553665-29553687 GTTCTTGGAGCTGTGAGGTGAGG - Exonic
949504487 3:4714274-4714296 GTTCTTTGGCCTGGGTGCTGAGG + Intronic
953080463 3:39611919-39611941 GCTCTTTCACCTGCTGGGTGAGG - Intergenic
961206459 3:125086284-125086306 GCTCTGTGGGCTGTGAGGTGGGG - Intronic
961660032 3:128463648-128463670 GCTCTGTGACCCAGGTGGTGTGG + Exonic
962891259 3:139675282-139675304 GCTCTTTGACCTGGGAGCTATGG - Intronic
967941242 3:194768225-194768247 CCTCTTTGAGATGTGTGCTGAGG + Intergenic
970832353 4:20356292-20356314 GATATTTGACCTGGGTGGAGAGG - Intronic
977847219 4:101780330-101780352 ATTCTCTGACCTGTTTGGTGAGG - Intronic
979217276 4:118180836-118180858 CCTCTTTTTCCTGTGTGGTTAGG - Intronic
979633893 4:122935419-122935441 GATCATTGATCTGTGTTGTGTGG + Intronic
981160812 4:141496469-141496491 GTTCTTTGACCGGTGCAGTGAGG + Intergenic
981697250 4:147571478-147571500 TCACTTTGCCCTGTGTGTTGTGG - Intergenic
982268226 4:153559846-153559868 GCTGTAAGACCTGCGTGGTGTGG + Intronic
983096013 4:163562830-163562852 GCTTTCTGACCTGAGTGATGGGG - Intronic
983418228 4:167484859-167484881 GCTGTTTGACCTTTGACGTGGGG + Intergenic
985649128 5:1099200-1099222 GCTCTTTGGCCCATGGGGTGGGG - Intronic
989967577 5:50483349-50483371 GCACTTTGACATGTAGGGTGTGG - Intergenic
990522355 5:56592334-56592356 GCTCTTTGAGCTGAGTTTTGAGG - Intronic
995282248 5:110349518-110349540 CCTGTTTTACCTGTGTGATGGGG + Intronic
995495214 5:112734873-112734895 TCTCTTGGACCTGGGAGGTGGGG - Intronic
996488762 5:124067672-124067694 GCTCCCTGACCTGTGGGTTGAGG - Intergenic
996908835 5:128633133-128633155 GTTCTCTGACCTGTGGGGTGAGG - Intronic
999946638 5:156604423-156604445 TCTTTTTTACCTCTGTGGTGTGG + Intronic
1001309683 5:170601999-170602021 GCTCTCTGCCCTCTGGGGTGAGG + Intronic
1003569407 6:7246473-7246495 GCTCTCTGTCCCGTGAGGTGAGG - Exonic
1003880709 6:10477246-10477268 GGTCTTTGGCCTGTGGGGTGAGG + Intergenic
1005529493 6:26688699-26688721 GGTCCTTGACCTCAGTGGTGAGG - Intergenic
1005541303 6:26812947-26812969 GGTCCTTGACCTCAGTGGTGAGG + Intergenic
1007026926 6:38585595-38585617 GCTCTTTGAGCTGGGTGCAGTGG - Intronic
1009012106 6:57855011-57855033 GGTCCTTGACCTCAGTGGTGAGG + Intergenic
1012001791 6:93663355-93663377 GTTCCCTGACCTGTGGGGTGAGG + Intergenic
1012523855 6:100153807-100153829 GCTCTTTGCCATGTGTGGAGAGG - Intergenic
1014278258 6:119412437-119412459 GCTCTTTTAACTTTTTGGTGAGG + Intergenic
1015236819 6:130980477-130980499 TCTCTTTGGCCTGTGGGGTCAGG - Intronic
1017112108 6:150941736-150941758 GAGGTTTGAACTGTGTGGTGTGG + Intronic
1018958902 6:168432252-168432274 CCTTTTGGGCCTGTGTGGTGAGG + Intergenic
1019127927 6:169853649-169853671 GCTCATTGCCCTGTCTGATGGGG + Intergenic
1021738777 7:23664499-23664521 ACTCTGTGTCCTGTGTGGTGTGG - Intergenic
1021830061 7:24597451-24597473 ACTCTTTGAAAAGTGTGGTGGGG + Intronic
1022245895 7:28559040-28559062 GCTCTCACACCTGTGTAGTGTGG - Intronic
1023538794 7:41242220-41242242 GCTCATTGACTTGTTTGGAGAGG - Intergenic
1023542027 7:41275812-41275834 ACTCTTTGCACTGTGTGGTTTGG - Intergenic
1025807282 7:64846468-64846490 GGTCTTTCACCTCTGTGGTTAGG + Intergenic
1026131773 7:67626888-67626910 GCTCATAGACCAGTGTGGAGAGG - Intergenic
1028141597 7:87280870-87280892 GCTCCCTGACCTGTAGGGTGAGG + Intergenic
1028237681 7:88381721-88381743 GCTCCTTGACTAGTATGGTGAGG + Intergenic
1032597583 7:133257107-133257129 GCCCTTAGGCCTGTGAGGTGGGG + Intronic
1034825141 7:154255480-154255502 GCTCTTTGAATTCTGCGGTGCGG + Intronic
1035328060 7:158077565-158077587 GCACTCAGCCCTGTGTGGTGGGG - Intronic
1035681949 8:1494796-1494818 GCTCTGTGTGCTCTGTGGTGTGG - Intergenic
1036212068 8:6850369-6850391 GCCCATTGACCTCTGTGGTCAGG - Intergenic
1038412140 8:27367226-27367248 GCTCTTTGTCCTGTGAGGCCTGG + Intronic
1038644015 8:29348773-29348795 GCTCTTTGATGGGTGTGGGGGGG + Intronic
1040629801 8:49197179-49197201 GTTTTTTGACCGATGTGGTGGGG - Intergenic
1043248912 8:78044059-78044081 GCTGTTTTATCTATGTGGTGAGG + Intergenic
1046064074 8:109175862-109175884 GTTCCCTGACCTGTGGGGTGAGG - Intergenic
1047842720 8:128771194-128771216 GCTCTTTCACCTCTTTGGTTAGG - Intergenic
1048183661 8:132219035-132219057 ACACTATGACCTCTGTGGTGTGG + Intronic
1049396181 8:142402249-142402271 GTTCTGTGAGCGGTGTGGTGCGG - Intronic
1049463177 8:142739427-142739449 GCTCTCTGAACTCTGTGCTGCGG + Intergenic
1050362158 9:4840414-4840436 TTTCTTTGACATGTGTGGTTGGG + Intronic
1052999203 9:34568262-34568284 GCTCCTTGTCCTGTGGGCTGTGG + Intronic
1055154019 9:73038779-73038801 GACCTTTGACCTGTGTGGGAAGG - Intronic
1056822834 9:89855486-89855508 GCTCTTTTGCCTGTGTCCTGAGG - Intergenic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1058421159 9:104834784-104834806 GCCCTGGGACCTGTGGGGTGAGG + Intronic
1060021804 9:120137929-120137951 GCTCTTTGCACTATGTGTTGGGG - Intergenic
1060660019 9:125399832-125399854 CCGCTTTGCCCTGTGTGGCGAGG + Intergenic
1062053039 9:134457205-134457227 CCTCTATGTCCTGTGGGGTGGGG + Intergenic
1062053059 9:134457279-134457301 CCTCTGTGTCCTGTGTGGTGGGG + Intergenic
1062053080 9:134457353-134457375 CCTCTGTGTCCTGTGTGGTGGGG + Intergenic
1062053099 9:134457427-134457449 CATCTGTGTCCTGTGTGGTGGGG + Intergenic
1062053136 9:134457537-134457559 CCCCTGTGTCCTGTGTGGTGGGG + Intergenic
1062053161 9:134457611-134457633 CCTCTGTGTCCTGTGGGGTGGGG + Intergenic
1062053186 9:134457685-134457707 CCTCTGTGTCCTGTGGGGTGGGG + Intergenic
1062203449 9:135321415-135321437 GCTCTTTCACAGGTGTGGAGAGG + Intergenic
1185489526 X:510532-510554 TCTCTTTTACCTTCGTGGTGAGG + Intergenic
1187440972 X:19319356-19319378 TCTCTGTGATCTGTGTGGTTTGG - Intergenic
1189376541 X:40471118-40471140 TTCCTTTGGCCTGTGTGGTGTGG + Intergenic
1190375863 X:49787768-49787790 GGTCTTTGAATTGTATGGTGGGG + Intergenic
1190721984 X:53156352-53156374 GTTCTCTGACCTGTGGAGTGAGG - Intergenic
1192954634 X:76056188-76056210 GATCTTTTACCTCTGTGGTTAGG + Intergenic
1194906564 X:99583931-99583953 GCTCTTTCACCTCTCTGGTTAGG + Intergenic
1194907121 X:99591973-99591995 GCTCTTTCACCTCTTTGGTTAGG - Intergenic
1198682627 X:139199051-139199073 GCTCATTGTCCTGTGTAATGTGG - Intronic