ID: 1071827060

View in Genome Browser
Species Human (GRCh38)
Location 10:89335973-89335995
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071827055_1071827060 10 Left 1071827055 10:89335940-89335962 CCTTCATACAGGGTAGTTAGAAT No data
Right 1071827060 10:89335973-89335995 AGCCAAATTGAAAACCCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type