ID: 1071827790

View in Genome Browser
Species Human (GRCh38)
Location 10:89342429-89342451
Sequence TTGTTTAAGGAGCAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 422}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071827790_1071827795 -9 Left 1071827790 10:89342429-89342451 CCATCCTCCTGCTCCTTAAACAA 0: 1
1: 0
2: 2
3: 43
4: 422
Right 1071827795 10:89342443-89342465 CTTAAACAAAAGAACCTTTAGGG No data
1071827790_1071827797 6 Left 1071827790 10:89342429-89342451 CCATCCTCCTGCTCCTTAAACAA 0: 1
1: 0
2: 2
3: 43
4: 422
Right 1071827797 10:89342458-89342480 CTTTAGGGCAATTGTCTAAAAGG No data
1071827790_1071827794 -10 Left 1071827790 10:89342429-89342451 CCATCCTCCTGCTCCTTAAACAA 0: 1
1: 0
2: 2
3: 43
4: 422
Right 1071827794 10:89342442-89342464 CCTTAAACAAAAGAACCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071827790 Original CRISPR TTGTTTAAGGAGCAGGAGGA TGG (reversed) Intronic
901198859 1:7455540-7455562 TTGCTTATGAAGCAGGTGGAGGG - Intronic
903187719 1:21638572-21638594 TTGTTTAAAGAGAAAGAGGACGG - Intronic
903335416 1:22621246-22621268 ATGTTTATGGAGCAGGAAGAGGG - Intergenic
903491079 1:23729081-23729103 ATCTTGAAGGAGGAGGAGGAAGG - Intergenic
904498379 1:30900555-30900577 TTGTTTTGGGAGCAGGGGAAGGG - Intronic
904679039 1:32216033-32216055 TGGGTTTAGGAGCAGGAGAACGG - Exonic
905528369 1:38656495-38656517 CTGGTCAGGGAGCAGGAGGAGGG + Intergenic
905961962 1:42050472-42050494 TTGTTTTTGGAGGAGGAGGGAGG - Intergenic
906288872 1:44606368-44606390 TAGTTTTAAGAGAAGGAGGAAGG + Intronic
907157409 1:52347108-52347130 TTTTTTATGGAGAAGGAGAAAGG - Intronic
907229760 1:52985319-52985341 CAGTTTAAGCAACAGGAGGATGG - Intronic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
908952638 1:69580018-69580040 TTGTTCATGGACCAGGACGATGG - Intronic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
910747243 1:90587450-90587472 TTGTTTAAGGAGCAGTTAGGTGG + Intergenic
910760577 1:90727540-90727562 TTTTTAAAGGAACAGAAGGAAGG + Intergenic
911718464 1:101163199-101163221 TTGTTTTAGGAAGAGGGGGATGG + Intergenic
912128659 1:106573042-106573064 TTGTTTAAGGATGATGATGATGG - Intergenic
912775285 1:112502745-112502767 GTTTTTCAGGAACAGGAGGACGG + Intronic
912867049 1:113266987-113267009 GTGTTGGAGGAGCAGCAGGAAGG - Intergenic
913008428 1:114658146-114658168 AGGTTTAAGGAGAAGGAAGAAGG + Intronic
913499138 1:119454515-119454537 TTGTTTATGGAATAGAAGGAAGG - Intergenic
914701642 1:150139336-150139358 ATGTTTAAGGAACAGAAAGAAGG - Intronic
914915003 1:151814274-151814296 TTGTTGATGGAAGAGGAGGAAGG + Intronic
915638452 1:157202980-157203002 ATTTTTAAGGAGCTTGAGGAAGG + Intergenic
917156142 1:172001043-172001065 TTGATTTAGGAGAATGAGGATGG + Intronic
918585900 1:186188050-186188072 TTGGTCAAGGAGTGGGAGGAAGG - Intronic
918910308 1:190559310-190559332 TTGGTTTTGGAGAAGGAGGATGG - Intergenic
920717602 1:208355406-208355428 TTGTTTTGGCAGCAGGAGGCAGG + Intergenic
920987053 1:210900834-210900856 TAGGTTGAGGAGAAGGAGGATGG - Intronic
921900142 1:220441339-220441361 TTGTTTGAGGATGAGGAGGGTGG + Intergenic
923805639 1:237254599-237254621 TTCTTTAGAGAGGAGGAGGATGG + Intronic
1063503724 10:6578627-6578649 ATGTTCAATCAGCAGGAGGAAGG + Intronic
1063755126 10:8998654-8998676 GTTTTTAAGTAGGAGGAGGATGG + Intergenic
1064297781 10:14093994-14094016 ATGATAATGGAGCAGGAGGATGG + Intronic
1066638017 10:37526327-37526349 AAGTTTAAAGAGCAGAAGGATGG + Intergenic
1067183064 10:44005143-44005165 TTTTTCAAGGACCAGGAAGAAGG + Intergenic
1067400540 10:45969683-45969705 GTGTTTAAAGAGTATGAGGAAGG - Intergenic
1067553743 10:47253599-47253621 TTGCTGTAGGAGCAGGAGGGAGG - Intergenic
1068155776 10:53196528-53196550 TTGTTACTGGAGCAGAAGGAAGG - Intergenic
1068315006 10:55329572-55329594 TTGTTAAGGGAGCAAGATGAGGG + Intronic
1069321618 10:67178507-67178529 TTGTTCAAAAAGCAGGAGAAAGG - Intronic
1070617223 10:77978382-77978404 GTGCTGAAGGACCAGGAGGAGGG + Intronic
1070871488 10:79757796-79757818 TTGTTTCAGGGGAAGGAGGGAGG + Intergenic
1071719148 10:88125417-88125439 TTGTTTAGGGCTGAGGAGGACGG + Intergenic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1073017949 10:100417029-100417051 TTGATTAAGGTGGCGGAGGACGG + Intergenic
1073512897 10:104053469-104053491 ATTTTTAAGGAGCATCAGGAAGG - Intronic
1073608979 10:104924602-104924624 TTGATAAAGGAGCAAGAGGCTGG + Intronic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074385357 10:113012629-113012651 TTGAGTAAGGAGCTGCAGGAAGG + Intronic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075502768 10:122992155-122992177 TTGTTTAAAGAGCAGCATCAAGG - Exonic
1075993837 10:126860439-126860461 TTGTTTAATGGTCAAGAGGAAGG - Intergenic
1077514572 11:2993662-2993684 TTGTTTTTGGAGCAGGGGAAGGG - Intergenic
1078058180 11:8024499-8024521 TTCTCCAAGGAGCAGGAGGCAGG - Intronic
1078649669 11:13177037-13177059 CTGTTGAAGAAGCAGGAGCATGG + Intergenic
1078736164 11:14023070-14023092 TTGTTTAAGGAACTGGAGCTCGG + Intronic
1080104721 11:28499978-28500000 TTGTTTAAAGGGCAGGTGGTTGG + Intergenic
1080203186 11:29698099-29698121 TTGTTTAAGGAGGCCGAAGATGG + Intergenic
1080313531 11:30922940-30922962 TTGTTTAAGAAGAAGAGGGAAGG + Intronic
1080660052 11:34288603-34288625 TTGTTTTCGGCCCAGGAGGAGGG + Intronic
1080908035 11:36566505-36566527 GATTTTAAGGAGCAGGAGGATGG + Intronic
1081209797 11:40318714-40318736 TTCTGTAAAGAGCAGGTGGAGGG - Intronic
1083901131 11:65644104-65644126 TGGTTTAAGGAGGAGGAGCAGGG + Intronic
1084949869 11:72658677-72658699 TTTTTTTTGGAGCAGGAGAATGG + Intronic
1086241063 11:84692225-84692247 TGTTTTAAAGAGCAGGAGGTAGG - Intronic
1086427371 11:86699202-86699224 TTGTAAAATGAGTAGGAGGAGGG - Intergenic
1089100093 11:115955720-115955742 TTTCTTAGGGAGAAGGAGGAGGG - Intergenic
1089419400 11:118319859-118319881 GTGTTTAAGGAGCAGGGAGGAGG - Intergenic
1089749996 11:120644607-120644629 ATGTCTCAGGAGGAGGAGGAAGG + Intronic
1090418222 11:126555617-126555639 CTGCTTGAGGAGCAGCAGGAAGG + Intronic
1090678432 11:129027506-129027528 TTGGTAAAGGGTCAGGAGGAAGG - Intronic
1091309189 11:134560841-134560863 TTTTTTAAGCAGGAGGAGGAGGG - Intergenic
1091774223 12:3173843-3173865 TAATTTAAGGAGGAGGAGGGAGG - Intronic
1092522684 12:9290257-9290279 TTCTGCAAGGAGCAGGAGCAGGG + Intergenic
1092544601 12:9441640-9441662 TTCTGCAAGGAGCAGGAGCAGGG - Intergenic
1094350525 12:29519679-29519701 TTGTTGAAGTAAAAGGAGGAGGG + Intronic
1094508352 12:31080430-31080452 TTCTGCAAGGAGCAGGAGCAGGG + Intronic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1097040467 12:56153214-56153236 TTGTTTTAGGGGCAGGAGTGGGG - Intronic
1097085781 12:56467248-56467270 TTTTTTGAGGGGTAGGAGGATGG + Intronic
1097102311 12:56598417-56598439 TTACTTGAGGAGCAAGAGGAGGG + Exonic
1097775780 12:63643636-63643658 TTGGTTCAGCAGCAGAAGGATGG + Intronic
1097786406 12:63765028-63765050 TTGTTGAAAGAGAAGAAGGAAGG + Intergenic
1098168430 12:67720763-67720785 TGGTTTTGGGAGCAGGAGGATGG + Intergenic
1099127899 12:78789047-78789069 TTGTTTCAGGAACAGCAAGAAGG - Intergenic
1099196604 12:79624276-79624298 TAGTTGAGGGGGCAGGAGGAGGG - Intronic
1099397827 12:82163043-82163065 TCCTTTAAGAAGCAGGTGGAGGG - Intergenic
1099853437 12:88134259-88134281 TTGTTGGAGGAGAGGGAGGATGG - Intronic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1102424009 12:112826258-112826280 ATGTTGAGGGAGCAGCAGGAAGG + Intronic
1102647199 12:114411393-114411415 TTATTTAAGGAGAAGGGGCATGG + Intergenic
1102805072 12:115772524-115772546 TTGTTTCTGGAGCAAGAGTAGGG - Intergenic
1103083164 12:118041491-118041513 TTGCTAAAAGAGCAGGAGAAAGG + Intronic
1103669700 12:122603301-122603323 ATCTTTAAGGAGAAGCAGGATGG + Intronic
1103765775 12:123278774-123278796 TTTTTTAAGGAACAGGGGGCTGG + Intergenic
1104182899 12:126399502-126399524 GTGTTTAAGGAAGAGGAGAAAGG - Intergenic
1105410795 13:20169605-20169627 TATTTTAAGGAGCTGGAGAAGGG - Intergenic
1107420338 13:40240131-40240153 ATGTTTTAGGATCAGCAGGAAGG - Intergenic
1109103776 13:58222310-58222332 TTGATTAGTTAGCAGGAGGAAGG + Intergenic
1109261871 13:60154671-60154693 TTCTTTCAGTAGCAGCAGGATGG - Intronic
1110229478 13:73153380-73153402 TTGTTGAAAGAGAAGGAGGGAGG - Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111721882 13:91956249-91956271 TTTTTCCAGGAGCAGGAGGTTGG + Intronic
1113026831 13:105949528-105949550 TTTTTTGAGGAGTAGGAGGGTGG + Intergenic
1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG + Intergenic
1116039096 14:39664001-39664023 TTGTTCTGGCAGCAGGAGGAAGG + Intergenic
1116153619 14:41174496-41174518 CTGTTTAAGGTGCAAGAAGAGGG - Intergenic
1116705665 14:48295505-48295527 TTTTTAAATGAGCAGGAGGGAGG - Intergenic
1116916345 14:50529829-50529851 ATGTTTAAGGAGCAGCAAGCAGG + Intronic
1117209278 14:53478689-53478711 ATGTTTCAGGAGCATCAGGAGGG - Intergenic
1117321441 14:54627687-54627709 GGTTTAAAGGAGCAGGAGGAGGG - Intronic
1117815338 14:59592384-59592406 CTGATTAAGGAGCTTGAGGAGGG + Intergenic
1118436196 14:65772862-65772884 TTTTTGAAGAAGCAGGAGGGTGG + Intergenic
1118437204 14:65782403-65782425 TTGCTTAGTGAGTAGGAGGAGGG + Intergenic
1119438720 14:74613824-74613846 TTGTTCAAGGAGCAGAGAGAGGG - Intergenic
1120814970 14:88846462-88846484 TTGTTTAAGGAACAGTAAGAAGG + Intronic
1122148244 14:99706871-99706893 ATGTTAGAGGAGCAGGAGGGAGG - Intronic
1123466023 15:20516469-20516491 TTATAAAAGGAGCAAGAGGAAGG - Intergenic
1123652091 15:22484570-22484592 TTATAAAAGGAGCAAGAGGAAGG + Intergenic
1123742511 15:23293430-23293452 TTATAAAAGGAGCAAGAGGAAGG + Intergenic
1123760814 15:23431056-23431078 TTATAAAAGGAGCAAGAGGAAGG - Intergenic
1124138099 15:27052558-27052580 GTGTTTTAGAAGCAGCAGGAGGG - Intronic
1124220543 15:27846786-27846808 ATGTTGAAGGATCTGGAGGAGGG + Intronic
1124276747 15:28332445-28332467 TTATAAAAGGAGCAAGAGGAAGG - Intergenic
1124305953 15:28579161-28579183 TTATAAAAGGAGCAAGAGGAAGG + Intergenic
1124694643 15:31853814-31853836 TTGTTGAAGAAGAAGGATGAGGG - Intronic
1124801650 15:32838701-32838723 TTTTTTAATGAGCAGGAAGTAGG - Intronic
1125069294 15:35532745-35532767 TTTTTTAAAGAGGAGGAGGAAGG + Intronic
1125200183 15:37095994-37096016 TTGTTCAAGTAGCTGGAGGCGGG + Intronic
1125734231 15:41912337-41912359 TTGTTTAGGGCGCACCAGGAAGG - Intronic
1126188953 15:45859491-45859513 TTTTTGAAAGAGCAGGAGGCTGG - Intergenic
1126924729 15:53571380-53571402 TAGTTTCAGGAGCTGGAGGCAGG - Intronic
1127210787 15:56772482-56772504 TTAAATAAAGAGCAGGAGGAAGG + Intronic
1127327281 15:57907968-57907990 TTGTTTATGGGGTAAGAGGATGG + Intergenic
1127527993 15:59812996-59813018 TTGTTTAAGGAGGAGGAGACAGG - Intergenic
1128348225 15:66868827-66868849 TGGTTTGAGGAGCAGGAAGGTGG + Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1133401877 16:5494037-5494059 TTCTTAATGGAGCAGGAGGTGGG + Intergenic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1135677821 16:24432203-24432225 GTATTTAAGGAGCAGAAAGAAGG + Intergenic
1136051051 16:27650262-27650284 TTGTTCAAGGAGCAGGATGCAGG + Intronic
1136496939 16:30650749-30650771 TTTTTAAAGGAGCCGGAGGTGGG + Intronic
1137378903 16:47979490-47979512 TTGTAAAAGAGGCAGGAGGAGGG - Intergenic
1137527185 16:49246588-49246610 TTATTTGAGGGGCAGAAGGAAGG - Intergenic
1137875921 16:51996708-51996730 TGGTTTAAAGAGGGGGAGGAGGG - Intergenic
1139689297 16:68629688-68629710 TTGCCTGAGGAGCTGGAGGAAGG - Intergenic
1139972305 16:70783724-70783746 TTGTTTAATGTGCAGGGGAATGG + Intronic
1140923800 16:79564224-79564246 TTGTTTCAGGAGAAGACGGAAGG + Intergenic
1141017352 16:80463102-80463124 TTATTTACAGAGCAGGAGGCGGG + Intergenic
1141178172 16:81734372-81734394 GAGTGTGAGGAGCAGGAGGAGGG + Intergenic
1142029751 16:87832613-87832635 TTTTTTAAGGAGCTGGGGGAAGG - Exonic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1143153008 17:4818682-4818704 TTCTTTAAGGCCCAGCAGGAAGG - Intronic
1143264202 17:5623561-5623583 TTGATTAGGGAGGAGGAGAACGG + Intergenic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1146186834 17:30729718-30729740 ATGTTTCAGGAACAGGAGGGAGG + Intergenic
1146400232 17:32495632-32495654 TCGTGTGAGGAGCTGGAGGAAGG - Intronic
1146403105 17:32515729-32515751 TTGATTAAGTAGCAGGTGGTGGG + Intronic
1146516570 17:33494221-33494243 TTGTTTGGGGATCAGTAGGAAGG + Intronic
1146795956 17:35781088-35781110 ATGTTTAAGGAACAGAAGGAAGG + Intronic
1147052937 17:37810517-37810539 ATGTTCAAGGAACAAGAGGAAGG + Intergenic
1147710452 17:42459549-42459571 ATCATTAAAGAGCAGGAGGACGG + Intronic
1147976020 17:44248488-44248510 ATGTTCAAGGAGCAAGGGGAGGG + Exonic
1149098673 17:52876184-52876206 TTGTTGCAGGGGCAGGAGGTGGG + Intronic
1149313422 17:55418000-55418022 GTGTTTAAGGAGCAGAAAGGAGG - Intronic
1149333108 17:55606808-55606830 ATTTTTAAGAAGCAGGAGGAAGG - Intergenic
1149461356 17:56832687-56832709 GTGTTTAAGAGGGAGGAGGAGGG - Intronic
1150884029 17:69064407-69064429 TCCTATAAGGAGCAGGAAGATGG - Intergenic
1150929903 17:69573183-69573205 TTCTTAAAGGAGGAGGAAGAGGG - Intergenic
1151198796 17:72452607-72452629 CTGTTTAGAGAGCAGGAGGTGGG + Intergenic
1151874804 17:76861554-76861576 TCGTGGCAGGAGCAGGAGGAAGG + Intergenic
1152135779 17:78502530-78502552 TTGTTTAAAAAGCAGGTGCATGG - Intronic
1152365613 17:79854671-79854693 GTGTTTGAGGACCAGAAGGAAGG + Intergenic
1152763782 17:82124208-82124230 TTGTTTCAGGAGTAGGAACATGG + Intronic
1153440307 18:5110453-5110475 TTATAAAAGAAGCAGGAGGATGG + Intergenic
1154036109 18:10803981-10804003 GTGTTTCAGGTGCAGGATGAGGG - Exonic
1155697326 18:28698377-28698399 TGGAGTAAAGAGCAGGAGGACGG + Intergenic
1156137905 18:34067303-34067325 ATGTTTGAGGAGCAGCAGGGAGG + Intronic
1156147191 18:34197915-34197937 TTGTTAAAGGCCCAGAAGGAAGG + Intronic
1156341997 18:36218095-36218117 TGGTGGAAGGAGCAGCAGGAGGG + Intronic
1156848128 18:41693414-41693436 TTGTTTCAGGATCTGCAGGAGGG + Intergenic
1157494809 18:48149070-48149092 TTATTTAACCAGGAGGAGGAAGG + Intronic
1157972802 18:52289444-52289466 TTGTTTATGGAGGAGGAGATAGG - Intergenic
1158011343 18:52731653-52731675 TTATTTGAGGTGCAGCAGGAAGG + Intronic
1160677468 19:399093-399115 TTTTATACGCAGCAGGAGGAAGG - Intergenic
1162043345 19:7983614-7983636 TTGTTTATGGAGCAGAAAGATGG - Intronic
1162972062 19:14186779-14186801 ATGTTTCAGGAACAGGAGGGAGG - Intronic
1163627992 19:18401919-18401941 TTTTATAAGGAGCAGAGGGATGG + Intergenic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1164728545 19:30483562-30483584 TTGTTTAAGAAGCAGAAAGAGGG - Intronic
1165817987 19:38654747-38654769 TTGTTTATGGAGAAAGGGGAGGG - Intronic
1166326839 19:42056294-42056316 TTTTTTAAACAGGAGGAGGAAGG + Intronic
1167237479 19:48323654-48323676 TTGTTTAGGGAGCAGACAGAAGG - Intronic
1167943180 19:52963584-52963606 TTGTTTATTGAGACGGAGGAGGG - Intergenic
1168262659 19:55205270-55205292 TTGTTTAAGGGGCAGTAGGCAGG - Intronic
1168452582 19:56477665-56477687 TTGGTTAAAGAGCTCGAGGAAGG - Intronic
925635398 2:5937317-5937339 TTGTTTGAGGAACAGAAGGAAGG + Intergenic
926895440 2:17682428-17682450 TTGTTTCAGGAGCTGGAGCTGGG + Intronic
927055159 2:19360035-19360057 TTGTTTGAGGAGGAGTAAGAGGG + Intergenic
929079452 2:38107835-38107857 ATGTTTACATAGCAGGAGGAAGG - Intronic
929403485 2:41612702-41612724 TTTATTAAGGAGCAAAAGGAAGG + Intergenic
929781346 2:44959188-44959210 TTTTTCAAGTAGCAGGAGAAAGG + Intergenic
929811156 2:45190407-45190429 GCATTCAAGGAGCAGGAGGAAGG - Intergenic
931054238 2:58450859-58450881 ATTTTGAAAGAGCAGGAGGAAGG - Intergenic
931716659 2:65034197-65034219 GTGTTTAAAGAGCAGAAAGAAGG + Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
934692940 2:96375822-96375844 TAGTCTAAGCAGCAGGACGAAGG + Intergenic
935050249 2:99519041-99519063 TTGTTCAAGAAGCAGGAAAAAGG + Intergenic
935208216 2:100915022-100915044 TGGCTTAAGGAGCAGGAACAAGG + Intronic
935687846 2:105699913-105699935 GTGTTTGAGGAGGAGAAGGAAGG - Intergenic
936409084 2:112238094-112238116 TTGTAGAGGGAGCTGGAGGATGG - Intronic
937017637 2:118620260-118620282 GTGTTCAAGGGGCAGGAGCATGG - Intergenic
937171558 2:119876266-119876288 TTCTTTATGGAGCATGAAGAGGG + Intronic
937393404 2:121513439-121513461 TTTTTTAAAGAGAAGAAGGAGGG + Intronic
939669908 2:144997708-144997730 TTATTTAATGACAAGGAGGAAGG - Intergenic
940165345 2:150764556-150764578 TTGTGTAGGGAGCATGAGGCAGG - Intergenic
940972327 2:159907157-159907179 TGTTTTGAGGAGGAGGAGGAAGG + Intergenic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941000847 2:160202371-160202393 ATGTTTGTGGTGCAGGAGGAGGG + Intronic
941369206 2:164643491-164643513 GTATTTGAGGAACAGGAGGAAGG - Intergenic
941420997 2:165282558-165282580 TTGTTTAAGTAGCAGGAAAAAGG - Intronic
941463288 2:165795159-165795181 TTGTTGCAGCAGCAGAAGGAAGG - Intergenic
941520163 2:166532229-166532251 TTGTTCTAGGAGCTGCAGGAAGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942306393 2:174611499-174611521 TGGTATCAGGAGGAGGAGGAGGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
943628934 2:190228739-190228761 TTGTTTAAAGATTAGGGGGAAGG + Intronic
944186825 2:196958172-196958194 TTGGCTAAGGAGAAGAAGGAAGG - Intergenic
944742726 2:202628096-202628118 TTGTTTAAGGAACCAGAGGAAGG - Intergenic
944894085 2:204146092-204146114 GTGCTCAAGGAGCCGGAGGAAGG - Intergenic
945136511 2:206634604-206634626 TAGTTTAAGTAGCAGTGGGAAGG + Intergenic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
945179471 2:207077042-207077064 TGCTTTTAGGAGCAGGAAGAAGG - Exonic
945324996 2:208471830-208471852 TTGTGAAAGAAGCAGGAGGGGGG + Intronic
945477499 2:210302487-210302509 TTCTCTAAGGAACAGCAGGATGG - Exonic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946927753 2:224642681-224642703 TGGTTTGAGGAGCAGGAAGAAGG + Intergenic
947235374 2:227935926-227935948 TTGCTTAAGGAGGAAGAGGAGGG + Intergenic
947929441 2:233951461-233951483 TTGTACAAGGAGTAAGAGGAAGG - Intronic
948056527 2:235012813-235012835 TGGTCCAAGGAGCAGGAGGAAGG + Intronic
1168960018 20:1862542-1862564 TTGTGTGAGAAGCAGGAGCAAGG + Intergenic
1168980425 20:1998871-1998893 GTGTTTGAGGAGCAGCAGGGAGG - Intergenic
1169597675 20:7219022-7219044 TTGTTGAACTAGCAGGAGGTAGG + Intergenic
1170120800 20:12909587-12909609 TTGCTTAAGGGGCAAGAGGGAGG - Intergenic
1170137475 20:13090665-13090687 TTTTGTTAGGAGCATGAGGATGG - Intronic
1170792778 20:19521504-19521526 TTCTTGAAGGAGCATGAGGCTGG + Intronic
1171327266 20:24305569-24305591 GGGTTGAAGGAGGAGGAGGAAGG + Intergenic
1171401412 20:24875027-24875049 CTGCTTAAGGGGCAGGAGGTGGG - Intergenic
1172548274 20:35778973-35778995 TTGGGGAAGGAGCAAGAGGAGGG + Intronic
1172981595 20:38946553-38946575 TATATAAAGGAGCAGGAGGAGGG - Intronic
1174549858 20:51354636-51354658 CTCTTTAAGGAGCATGAGGAAGG - Intergenic
1174567724 20:51478817-51478839 GTGTTCAGGGAACAGGAGGATGG - Intronic
1175100534 20:56575827-56575849 GGGTTTAGGGAGGAGGAGGAGGG - Intergenic
1175353449 20:58343208-58343230 TTGAACAAGGAGCAGGAAGATGG - Intronic
1177201281 21:17959088-17959110 TTTTTTAGAAAGCAGGAGGAAGG + Intronic
1177265270 21:18775116-18775138 TTGCTCCAGGAGCAGGAGGGAGG - Intergenic
1177550597 21:22615821-22615843 TTGTTTAAGGAGGAGGACACAGG + Intergenic
1177646766 21:23908755-23908777 GTGTTTAAGGAGCACCAGGAAGG + Intergenic
1177703627 21:24672277-24672299 TGGTTCAAGAAGCAGGAAGATGG - Intergenic
1178115359 21:29411443-29411465 TGGTTGAATGAGGAGGAGGATGG + Intronic
1180999675 22:19982205-19982227 TGGGTTCAGGACCAGGAGGAAGG - Intronic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182540295 22:31036471-31036493 TAGTTTAAGGAACAGAATGAAGG - Intergenic
1182951320 22:34378753-34378775 TTGGGTAAGGAGCAGTAGGCTGG + Intergenic
1183453326 22:37907978-37908000 TTGTTTGAGGGGCAGGAGTGAGG + Intronic
1183998012 22:41650606-41650628 TCTTCTAAGGAGCAGGAAGATGG - Intronic
1184418293 22:44364561-44364583 CTGCTTAAGGAGAAGGATGAGGG + Intergenic
949388637 3:3534921-3534943 TTATTTAAGGAGAATGAGGAAGG - Intergenic
949841187 3:8321814-8321836 TGGTCTATGGACCAGGAGGATGG + Intergenic
950336189 3:12195399-12195421 TGGTTGCAGGAGCAGGAGAAAGG - Intergenic
950342334 3:12258386-12258408 GTATTCAAGGAGCAGGTGGATGG + Intergenic
950957375 3:17069084-17069106 TTATTTAAGGTGCAGAAGCATGG + Intronic
952044279 3:29299164-29299186 TTGCTTAAGTAACAGCAGGAAGG + Intronic
952788789 3:37181619-37181641 ATGTTTAAGGAGCAGTAACAAGG + Intronic
952909155 3:38167042-38167064 TTGTTTTAGGACCTGAAGGAAGG + Intronic
953027208 3:39152210-39152232 ATGGGTAAGGAACAGGAGGAGGG + Intronic
953405727 3:42658917-42658939 TTCTTTAAGGAGGAGAAGGAGGG + Exonic
953434762 3:42869644-42869666 TTGTTTGAGGACGCGGAGGATGG + Intronic
953563583 3:44013055-44013077 TTGGTGACGGAGGAGGAGGAAGG + Intergenic
953870367 3:46620946-46620968 TTGTTTAACATGCAGGAGAAGGG + Intronic
954594743 3:51814708-51814730 CTGCTTTAGGAGGAGGAGGAGGG - Intergenic
955421270 3:58740373-58740395 CTGCTCAAGGAGCAAGAGGATGG - Intronic
955914695 3:63894960-63894982 TTGTTGGGGGAGGAGGAGGAGGG - Intronic
956040504 3:65140234-65140256 TTGTTTGTGGAGAGGGAGGAAGG + Intergenic
956932704 3:74063645-74063667 TTGTTTGGGCAGCAGCAGGAGGG - Intergenic
957772185 3:84708045-84708067 CTGTTTAAGGAGGAAGAGGCGGG - Intergenic
958542292 3:95494265-95494287 TAATTTAAGGAGCACGAGGTTGG + Intergenic
959967935 3:112377385-112377407 TTGCTCAAAAAGCAGGAGGAGGG - Intergenic
960761865 3:121080623-121080645 TTGTTTAAGGAGGTGGAAGATGG + Intronic
961360519 3:126364505-126364527 TTCTTGAAGGAGCAGGAGGGAGG - Intergenic
961416592 3:126763329-126763351 TTGTTGAAAGAGGAGGGGGAGGG - Intronic
964242448 3:154612567-154612589 ATATTTAAGGAACAGGATGATGG + Intergenic
965311680 3:167135923-167135945 TTGTTTAAGGAGGAGAGGGAAGG + Intergenic
966401804 3:179555220-179555242 TTTTTTAAGCAGGAGGTGGAGGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
968332702 3:197885179-197885201 ATGTCTGAGGAGCAGCAGGAGGG - Intronic
968598736 4:1499145-1499167 TTGATGAACGAGCAGGTGGACGG + Intergenic
968688713 4:1978718-1978740 TTCTGTAAGGAGCACCAGGACGG + Exonic
970113926 4:12671431-12671453 TTGGCTGAGGAGGAGGAGGAGGG + Intergenic
972385641 4:38563010-38563032 GAGTTTGATGAGCAGGAGGAAGG - Intergenic
973303585 4:48617630-48617652 GTGTTAAAAGAGGAGGAGGAGGG + Intronic
973798020 4:54448811-54448833 TTGGTCAATGGGCAGGAGGAGGG - Intergenic
973906221 4:55533929-55533951 TTGTTTAAGATGCAGGAGAGTGG + Intronic
976035873 4:80820490-80820512 GTGTTTAAGGAACAGCAAGAAGG + Intronic
976258038 4:83119223-83119245 TTGTTTCGGGAACAGAAGGAAGG - Intronic
977933617 4:102775968-102775990 TTGATTAAGAAGCAGGCGGTGGG + Intergenic
978018228 4:103775173-103775195 TTGATCAAGAGGCAGGAGGATGG - Intergenic
978299135 4:107245939-107245961 TTGTTTCAGCAACAAGAGGAAGG - Intronic
978343597 4:107742418-107742440 TTGTTTAAGAAGCAGGCCTAGGG + Intergenic
979366958 4:119836919-119836941 TTGTTTCGGGAGCAGCAGGAGGG + Intergenic
980718337 4:136658290-136658312 TTTTTTAATGAGGAGGAGAAAGG - Intergenic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
982030632 4:151297088-151297110 TTGCTTCAGGAAAAGGAGGAAGG + Intronic
982132691 4:152244704-152244726 TTGTATAAGGACCAGCAGCAAGG + Intergenic
983320371 4:166189500-166189522 TTGTTCAGTGAGCAGGAGGGAGG + Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
984035097 4:174657407-174657429 TTGTATAAGGAGAAGGAAAAAGG + Intronic
984700316 4:182814793-182814815 TGGAGTAAAGAGCAGGAGGACGG - Intergenic
985338518 4:188922075-188922097 TTGTTCAGTGAGAAGGAGGAAGG - Intergenic
986106297 5:4662551-4662573 TTGTTACAGGAGAAGGAGCAAGG + Intergenic
987875878 5:23680656-23680678 GTGTTTTAGGAGATGGAGGAGGG + Intergenic
989295970 5:39827028-39827050 TTATTTAAAGTACAGGAGGAAGG - Intergenic
990174050 5:53087380-53087402 TTGTGTAAGCAGGAGGAGAAAGG - Intronic
990196236 5:53319611-53319633 TTCCTGAAGGAGGAGGAGGATGG - Intergenic
991341485 5:65615511-65615533 TTTTTTAAGAGCCAGGAGGAAGG - Intronic
992850146 5:80798715-80798737 TTGTTTCAGAAGCAGGAGAGAGG - Intronic
993423051 5:87725971-87725993 TTTTCTAAAGAGCAGGATGAGGG - Intergenic
994080737 5:95706397-95706419 TTGTGGCTGGAGCAGGAGGAAGG - Intergenic
994081620 5:95713470-95713492 TTGTGGCTGGAGCAGGAGGAAGG - Intergenic
994165413 5:96602959-96602981 GTGTTCAAGGACCAGGATGAAGG + Intronic
995098469 5:108269187-108269209 GCTTTTAAGGAGTAGGAGGAAGG + Intronic
996031203 5:118705841-118705863 CAGTTTAAGGAGCAGGGAGAAGG - Intergenic
996164339 5:120206589-120206611 TTATTTTAGGATCAGTAGGATGG + Intergenic
996507563 5:124285454-124285476 GTCTTTAAAAAGCAGGAGGAGGG + Intergenic
997279130 5:132627594-132627616 GTGTTCAAGGACCAGGAAGAAGG + Intronic
997794507 5:136795164-136795186 TTGATGAAGGAGCAGAAGCATGG + Intergenic
998149902 5:139750915-139750937 TTCTTTGAGGAGTAGTAGGAGGG - Intergenic
998194977 5:140060965-140060987 GTGTTTAAGGAACAGCAGGTTGG - Intergenic
998334051 5:141355303-141355325 GTGTTTGAGGAGCAGGAAGAAGG + Exonic
998451149 5:142235597-142235619 TGGGCAAAGGAGCAGGAGGAGGG - Intergenic
998677201 5:144423132-144423154 ATGTTTGAGGAACAGAAGGAAGG + Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999625704 5:153517987-153518009 CTGTTTAAGGAACTGAAGGAAGG - Intronic
1000268453 5:159659989-159660011 GTGTTCAAGGACCTGGAGGAAGG + Intergenic
1001480973 5:172089084-172089106 TTGTTTAAGGGACTGGTGGAGGG - Intronic
1002574873 5:180168829-180168851 TGGTTTGAGGAACGGGAGGAGGG - Intronic
1002958224 6:1889388-1889410 TTTTTTAAGGACCAAGAAGAAGG - Intronic
1003725958 6:8764313-8764335 TTTTAGAAGGACCAGGAGGAAGG - Intergenic
1004829178 6:19458805-19458827 TTTTTAAAGGAGGAGGAGGAAGG + Intergenic
1006183175 6:32166209-32166231 TGGTATCAGTAGCAGGAGGAAGG - Exonic
1006948449 6:37801222-37801244 TTGTTTAAGGAGTCGGTGGAGGG - Intergenic
1007208096 6:40169173-40169195 AAGTTTAAGGAGGAAGAGGATGG - Intergenic
1008395415 6:51000891-51000913 TTGTTTAAAGTGGAGAAGGAGGG - Intergenic
1008683880 6:53903206-53903228 TTGATCAAGGAGCCAGAGGATGG + Intronic
1009979132 6:70705672-70705694 GTGTTTAAGGAGTGGCAGGATGG + Intronic
1011173399 6:84531688-84531710 TTGATTAAAGAGCAAAAGGAAGG + Intergenic
1014963119 6:127711791-127711813 TTTCTTAGGGAGCAGGGGGATGG + Intronic
1015222814 6:130824409-130824431 TTGTTTAAGACATAGGAGGAAGG - Intergenic
1016042600 6:139446654-139446676 TTGTTGAAAGAGCAAGAGGCAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1017853552 6:158328166-158328188 AAGTTGGAGGAGCAGGAGGAGGG + Intronic
1017936240 6:159007758-159007780 ATGTTTAAGGAGCAAAAGGAAGG + Intergenic
1018002218 6:159589387-159589409 GTGTGTAAAGAGCAGGAGGCTGG - Intergenic
1018012338 6:159682959-159682981 TGGTCTTAGGAGCAGCAGGAAGG + Intronic
1020022415 7:4877123-4877145 TTGTCTACGCAGCAGGAGGCTGG - Intronic
1021758308 7:23877402-23877424 TGGGTTAAGGAGGAGGATGATGG + Intergenic
1022363942 7:29690997-29691019 TTGGTTCAGCAGCAGAAGGATGG - Intergenic
1022605284 7:31807325-31807347 TTGTTTAATGAGCAGGATTCTGG - Intronic
1022697425 7:32722732-32722754 TTGGTTCAGCAGCAGAAGGATGG + Intergenic
1022868189 7:34445104-34445126 GTGTTTGAGGAGCAGAAAGAAGG + Intergenic
1022934681 7:35161234-35161256 TTGGTTCAGCAGCAGAAGGATGG + Intergenic
1023326823 7:39069820-39069842 TAGGTTGAGGAGGAGGAGGAAGG + Intronic
1023420851 7:39977999-39978021 GTATTTAAGGAGAAGGAGGGTGG + Intronic
1024010043 7:45259446-45259468 TTTTCTAGGGAGCAGCAGGATGG - Intergenic
1024022913 7:45387504-45387526 TGTTTTAGGGAGCAGCAGGAGGG + Intergenic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1025209096 7:57010522-57010544 TTATTTCAGGAGCTGGAGTAGGG + Intergenic
1025662853 7:63566336-63566358 TTATTTCAGGAGCTGGAGTAGGG - Intergenic
1026808575 7:73443581-73443603 TTGGTTAAGGAGCAGAGGGGAGG + Intronic
1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG + Intronic
1029830622 7:103254014-103254036 TTGGTTCAGCAGCAGAAGGATGG + Intergenic
1032434287 7:131887560-131887582 TTGTGTTAGGAGCAGGGTGAGGG - Intergenic
1034041684 7:147884179-147884201 GTGTTTAAGGAGCAGCAAGATGG + Intronic
1035063772 7:156090824-156090846 TTGTTTCAGGCTCAGGAGAATGG + Intergenic
1035860051 8:3018837-3018859 TTGTTTCAGGAGCATAAAGATGG - Intronic
1036127518 8:6076535-6076557 TTCTTTCAGAAGCAGGTGGAGGG - Intergenic
1036154019 8:6325346-6325368 TGGAATAAGGAGCTGGAGGATGG - Intergenic
1036525155 8:9528194-9528216 TTTTTTAAGGACTAGGAGCAGGG - Intergenic
1038296338 8:26293657-26293679 TTTTTCCAGGAGCTGGAGGAGGG + Exonic
1038848029 8:31247901-31247923 TTGTTAATTGAGCTGGAGGAAGG + Intergenic
1039179088 8:34843814-34843836 TTGTGTAAGGAGAATGAGAAGGG + Intergenic
1039347047 8:36716668-36716690 GTGATTCAGGAGGAGGAGGAAGG - Intergenic
1039838250 8:41275017-41275039 TTTTTTGAGGAGGAGGAGGGAGG + Intronic
1039945132 8:42122448-42122470 TTGCTGTAGGAGCAGGTGGATGG - Intergenic
1041053974 8:53963697-53963719 TTGTTTATCCAGCTGGAGGATGG - Intergenic
1041689227 8:60672993-60673015 TTGTTTAAGTGGCAGGGGTAAGG - Intergenic
1041733554 8:61087081-61087103 TTGATTTCGGAGCTGGAGGATGG - Intronic
1041843901 8:62305032-62305054 TGGTTTAAAGATCAGAAGGAGGG + Intronic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1043096209 8:75977245-75977267 TTGTGTAAGGAGCAGAGGCAGGG + Intergenic
1043629247 8:82308081-82308103 CTGTTTAAGGAGCAAGTGTAGGG - Intergenic
1043884566 8:85583636-85583658 TGGTTACAAGAGCAGGAGGAGGG + Intergenic
1044188094 8:89280734-89280756 GTGTTTTAGGAGATGGAGGAGGG - Intergenic
1044252895 8:90024892-90024914 TTGTATAAGGAGTAAAAGGAAGG + Intronic
1045412225 8:101930529-101930551 GTGGTCAAGGAGCTGGAGGAGGG - Intronic
1046138301 8:110060012-110060034 TTTTTAAAGGAACAGGATGAGGG - Intergenic
1046357431 8:113107041-113107063 TTGTCTAAGGCCCAGGGGGAAGG - Intronic
1046732871 8:117744516-117744538 TTGCTGAAGGAGCATCAGGAAGG - Intergenic
1046786073 8:118268127-118268149 TAGGTTAGGGAGCAGAAGGAGGG - Intronic
1047446327 8:124923442-124923464 TTTTGTAAGGAGCATAAGGAAGG - Intergenic
1048260847 8:132943873-132943895 CAGTTTAAGGAGCAAGAGAAGGG - Intronic
1048688002 8:136925894-136925916 TTCTTTGAGGAGCTGGAGGAGGG - Intergenic
1048752663 8:137697637-137697659 TTGATTGAGGAGCAGGAGGTCGG - Intergenic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1049949105 9:627263-627285 TGGTTTAGGGAGAAGGAGGAGGG - Intronic
1050143093 9:2537263-2537285 GTGCTAAAGGAGCATGAGGATGG + Intergenic
1050203486 9:3173894-3173916 TCGTGGAAGGAGAAGGAGGAGGG + Intergenic
1050478451 9:6064880-6064902 TTGCTGAAGGGGCATGAGGAAGG + Intergenic
1050751054 9:8937702-8937724 TTTTGTAAGAAGGAGGAGGAAGG - Intronic
1051912134 9:22165154-22165176 TTGTTAAAGCAGGAGGAGGGAGG + Intergenic
1052721443 9:32175593-32175615 TTATTTAGGGAGCAGGAGTGAGG - Intergenic
1052923500 9:33992593-33992615 TTGCTTGAGGGGCAGTAGGATGG - Intronic
1053052518 9:34973603-34973625 TCGTCTAAGCAGCAGGAAGAAGG - Intronic
1054863362 9:69975290-69975312 TTGTTAAAGGAGCAGGTGTCAGG - Intergenic
1054920665 9:70539493-70539515 TTGGTTATGGGGCAGCAGGAGGG - Intronic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1056512831 9:87321875-87321897 TGGTCTATGGAGTAGGAGGAAGG - Intergenic
1056564835 9:87761908-87761930 GTGTTTCAGGAGGAGGAGGTAGG + Intergenic
1056983861 9:91342879-91342901 TAGGTTAAGGAGAAAGAGGAGGG - Intronic
1058643949 9:107113123-107113145 TTTATTAATGAACAGGAGGAAGG - Intergenic
1059538202 9:115103817-115103839 CTGTTCAAGGGGCAGGAGGGAGG - Intronic
1059839721 9:118200401-118200423 TTGTTTGAGGAACAGAAAGAGGG - Intergenic
1060246781 9:121953139-121953161 TAGTTTAAGGAGGAGGAAAATGG + Intronic
1060463670 9:123883024-123883046 GTGTTTGAGGAGCAGAAAGAAGG - Intronic
1061075102 9:128336431-128336453 GTGTTCAGGGAGCAGGATGAAGG - Intergenic
1203774594 EBV:65646-65668 TTGTTTAACGAGCGAGAGGGAGG - Intergenic
1186739876 X:12506021-12506043 GTGTTTATGGAGCAGCCGGAGGG - Intronic
1187049999 X:15686357-15686379 TTGTTTAAAAAGGAGGAGGTGGG + Intergenic
1187485753 X:19701550-19701572 TTGTGTTAGGTGCTGGAGGAAGG - Intronic
1187499148 X:19824463-19824485 TTGTTTTGGGGGCAGGAGTAGGG - Intronic
1187699042 X:21947187-21947209 ATGCTGAAGGAGCGGGAGGAAGG - Intronic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1191996439 X:67100733-67100755 TGCTGTAAGGTGCAGGAGGAAGG + Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1193978666 X:88155148-88155170 TTGTTTGAGGAACAGCAAGAAGG + Intergenic
1194113221 X:89864096-89864118 CTGTTTAAGTTGCAGGAGAAGGG - Intergenic
1194123353 X:89986968-89986990 TTGCTCAGCGAGCAGGAGGAAGG + Intergenic
1195345833 X:103950323-103950345 TTGTTTGAGGAACAGCAGGGAGG + Intronic
1195361765 X:104089114-104089136 TTGTTTGAGGAACAGCAGGGAGG - Intergenic
1195394208 X:104393605-104393627 GTGCTTGAGGAGCAGCAGGAAGG + Intergenic
1195709893 X:107765306-107765328 TCCCTTAAGGAGCAGGAGGCTGG + Intronic
1196001617 X:110793427-110793449 TTCTTTAAGGAGCAGGGAGGAGG - Intronic
1196273724 X:113741807-113741829 TTGTTTAAGCAGTTGGAGGTTGG - Intergenic
1196490372 X:116258574-116258596 TTGTTTAAGAAACAGCATGAAGG + Intergenic
1196781172 X:119385736-119385758 TTGTTTATGGATCAGCAGAAAGG + Intergenic
1197569261 X:128129005-128129027 TCGTTTAAGGATCTGGAGGATGG - Intergenic
1198201037 X:134419021-134419043 TTGTTTTTTGAGGAGGAGGAAGG + Intronic
1200465906 Y:3519155-3519177 CTGTTTAAGTTGCAGGAGAAGGG - Intergenic
1200476238 Y:3644585-3644607 TTGCTCAGAGAGCAGGAGGAAGG + Intergenic
1201279986 Y:12333626-12333648 TTGTTTAGAAAACAGGAGGAAGG - Intergenic