ID: 1071829859

View in Genome Browser
Species Human (GRCh38)
Location 10:89360910-89360932
Sequence GAGGCAAGGAAGGATGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 1, 2: 5, 3: 46, 4: 443}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071829859_1071829866 8 Left 1071829859 10:89360910-89360932 CCCGCAGCATCCTTCCTTGCCTC 0: 1
1: 1
2: 5
3: 46
4: 443
Right 1071829866 10:89360941-89360963 TGCCATGCTCTCTCTTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071829859 Original CRISPR GAGGCAAGGAAGGATGCTGC GGG (reversed) Intronic
900397823 1:2460437-2460459 CAGGCAAGGAAGGACGCAGAGGG + Intronic
900581767 1:3413025-3413047 GAGGCCAGGACGGGTGCTCCTGG + Intronic
900754345 1:4423317-4423339 GAGGGAAGGAAGGAACCTGGAGG - Intergenic
900993609 1:6108874-6108896 GAGGCATGGAGGGATGATGGAGG + Intronic
901421127 1:9151860-9151882 GAGGAAAGAAAGGATGCAGGAGG + Intergenic
901576844 1:10208231-10208253 AAGGCAAAGAAGGCTGCTCCAGG - Intergenic
901712444 1:11126309-11126331 GAGGCCAGGGAGGAGGCAGCTGG - Intronic
902517945 1:16999969-16999991 CAGGGGAGGAAGGAAGCTGCAGG + Intronic
904539635 1:31224183-31224205 GAGGGAGGGAAGGGGGCTGCTGG - Intronic
905029265 1:34870572-34870594 CAGGCCCAGAAGGATGCTGCAGG + Intronic
905353397 1:37363240-37363262 GAGGCAAAGGAGGATGGGGCGGG - Intergenic
905876378 1:41434383-41434405 CAGTCAAGGAAGGAGGCAGCAGG - Intergenic
906580424 1:46930942-46930964 AGGGCAAGGAAGGATGTTTCTGG - Intronic
906639864 1:47435209-47435231 CTGGCAAGGAAGGAAGCTACTGG + Intergenic
906816303 1:48883373-48883395 TAGGCAAGGAAGGATGTAGCAGG - Intronic
908109972 1:60887136-60887158 GAGGCCTGGAAGGATGCAACAGG + Intronic
908935097 1:69365781-69365803 TAGGTAAGGAAGAAAGCTGCAGG - Intergenic
909481508 1:76132321-76132343 GAGGGAAGGCAAGCTGCTGCTGG - Intronic
910116480 1:83737361-83737383 GAGACAAGGAAAGAAGCTTCAGG + Intergenic
911039673 1:93582024-93582046 GAGGGATGGCAGGCTGCTGCCGG - Intronic
911057900 1:93723462-93723484 GAGTCAATGGAGGATGCTGAAGG - Intronic
911122420 1:94309663-94309685 GAGGGAGGGATGGATGATGCAGG + Intergenic
911283579 1:95961269-95961291 GAGGCTGGGAAGGATACTGGAGG - Intergenic
915049669 1:153055296-153055318 GAGGCAAGGAAGGGTGTTCAGGG + Intergenic
915321152 1:155057156-155057178 GTGGCAAGGAAGGTTGGGGCTGG - Intronic
915394458 1:155572222-155572244 GAGGGAAGGGAGGATGCTATTGG - Intergenic
919772638 1:201172414-201172436 GAGGCAAGGCAGGAGGTTTCGGG + Intergenic
920255637 1:204652276-204652298 GAGGCAAGGAGGAAGGCGGCGGG - Intronic
920347783 1:205317680-205317702 GCGGCAGGGAGGGAGGCTGCAGG - Intronic
920561576 1:206942522-206942544 GAAGCAAGGACAGCTGCTGCTGG - Intronic
920764771 1:208821667-208821689 AAGGGAAGGCAGGCTGCTGCTGG + Intergenic
921540758 1:216411739-216411761 GAGACAAGGAAGGATTCTAGAGG + Intronic
921557141 1:216612357-216612379 GAGGGAAGGAAGGAAGGGGCGGG + Intronic
922621558 1:226992411-226992433 GAGGGAAGAAAGGATCCTGCTGG - Exonic
922707145 1:227795643-227795665 GAGGGAAGGAAGGAGGTTGGGGG - Intergenic
922767041 1:228161596-228161618 GGGCCAAGGAGGGAGGCTGCAGG - Intergenic
922903279 1:229154862-229154884 GATGCAGGGAAGGAAGCTGTCGG + Intergenic
923036420 1:230287942-230287964 AAGGAAAGGAAGGAAGGTGCGGG + Intergenic
923515951 1:234698251-234698273 GAGGCAAGGCAGGATGGGGGTGG - Intergenic
923561182 1:235043167-235043189 GAAGCAAAGAAGGATGCTCATGG - Intergenic
924107697 1:240666006-240666028 GATGCTAAGAACGATGCTGCAGG - Intergenic
924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG + Intronic
924570399 1:245232844-245232866 GAGGAAAGGAAGGAAACCGCCGG - Intronic
1065746115 10:28844151-28844173 GAGGAAAGGAAGGAGCCTGGAGG + Intergenic
1065916756 10:30359552-30359574 GGGGAAAGGAAGGATGGTGGGGG - Intronic
1066429227 10:35336501-35336523 GCGGCCAGGGAGGATGCTGGCGG - Intronic
1067070025 10:43124417-43124439 CAGGCAAGCAAGGACGGTGCAGG + Intronic
1067343090 10:45419777-45419799 CAGGCAAGGAAGGCTGCGGAGGG + Intronic
1067398998 10:45953667-45953689 GAGGCAAGGAAGGATTCCTAGGG - Intergenic
1067867320 10:49922879-49922901 GAGGCAAGGAAGGATTCCTAGGG - Intronic
1069400156 10:68035815-68035837 CAGGGAAGGAAGGCTCCTGCTGG - Intronic
1070328042 10:75400598-75400620 GAGGGCAGGAAAGATGCTGCTGG - Intronic
1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG + Intergenic
1071406293 10:85336224-85336246 GAGGCTGGGAAGGATACTGGGGG + Intergenic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1072550559 10:96474184-96474206 GCGGCAAGAAAGGATTCTTCAGG - Intronic
1072976214 10:100061077-100061099 GAGGCTGGGAAGGATGGTGGGGG + Intronic
1073255307 10:102147085-102147107 GGGGCAAGGCAGGGTGCTGAGGG - Exonic
1073516379 10:104079101-104079123 GTGGGAAGGAAGGGTGCTCCTGG + Intronic
1073607251 10:104908940-104908962 CAGGCAGGGAAGGATGCTCTAGG + Intronic
1074024186 10:109616596-109616618 GAGGAGAGGAAGGAAACTGCAGG + Intergenic
1074100785 10:110353570-110353592 AAGGCAGGGAGGGAGGCTGCTGG + Intergenic
1074110995 10:110422841-110422863 GAGGGAAGGAAGGAGGCTATAGG + Intergenic
1074384938 10:113009302-113009324 GAGACAGGGAAGGCTGCTCCAGG - Intronic
1074865792 10:117543709-117543731 GGGGCAGTGAAGGATGCGGCGGG - Intronic
1074872336 10:117587131-117587153 GAGCCAAGGAAAGATGGTGGAGG - Intergenic
1075444476 10:122504155-122504177 CAGGCAGGGATGGAGGCTGCAGG - Intronic
1076214001 10:128678471-128678493 TAGGCAGGGAGGGAGGCTGCAGG + Intergenic
1076543680 10:131230007-131230029 GAAGCAAGGAAGGGAGCAGCAGG + Intronic
1076715635 10:132362499-132362521 AAGGCAAGGACGGAAGCTGGAGG + Intronic
1076907371 10:133369776-133369798 GAGGCAGGAAAGGAGGCTGCTGG + Intronic
1077358637 11:2130043-2130065 GAGACAAGGCAGGGTGCTGAGGG + Intronic
1077938726 11:6817830-6817852 GAGGCATGGCAGAAGGCTGCAGG + Intergenic
1078805238 11:14693155-14693177 GAGAGAAGTAAGGAAGCTGCAGG + Intronic
1080601320 11:33822743-33822765 GAGGCTAGGAAGGATACTGAGGG - Intergenic
1080836911 11:35947799-35947821 AAGGCATGGAAGCATGGTGCAGG - Intronic
1081501324 11:43669601-43669623 GAGGCAAGGAAGGATGCTTCTGG - Intronic
1081707088 11:45188791-45188813 CAGGCCAGGAACCATGCTGCTGG + Intronic
1082854209 11:57791828-57791850 GAGACAAGGAATATTGCTGCTGG + Intronic
1082884196 11:58066589-58066611 GAGGCAAGGATGGGGGCTGCTGG - Intronic
1083168246 11:60905286-60905308 CATGCCAGGAAGGATGGTGCTGG + Intronic
1083199269 11:61110012-61110034 GAGGCTAGGAAGGATGGTGCAGG + Intronic
1084508043 11:69582208-69582230 ATGGCAAGGAAGTATCCTGCTGG + Intergenic
1084739770 11:71132086-71132108 GAGGCAGGTGAGGCTGCTGCCGG + Intronic
1084953017 11:72677072-72677094 GATGGCAGGAAGGATGCTCCTGG + Intergenic
1085021768 11:73214505-73214527 AAGGGAAGGGAGGATGGTGCAGG + Intergenic
1085053741 11:73392540-73392562 GAGGCCAGGCAGGATTCCGCTGG - Intronic
1086037315 11:82432245-82432267 TAGGCAAGGATGGTTGCTTCTGG - Intergenic
1086728906 11:90223375-90223397 AAGGCAAGGAAGAAGGGTGCTGG - Intergenic
1088005703 11:104937246-104937268 GAGGCTAGGAAGCATACTGTGGG + Intergenic
1088344854 11:108811400-108811422 CAGGTAAGGAAGGATACTCCAGG + Intronic
1089078566 11:115758699-115758721 GAGGCAAGGAGGGATGGTGGGGG + Intergenic
1089198678 11:116710526-116710548 GGGCCGAGGGAGGATGCTGCAGG - Intergenic
1089688295 11:120170482-120170504 GGGGCAGGGAAGGGGGCTGCAGG - Exonic
1090056568 11:123429799-123429821 GAGGAAAGCAAGGTTGCTGGAGG - Intergenic
1090185847 11:124738727-124738749 GAGGAAAGGATGGCTCCTGCTGG - Intergenic
1090320216 11:125836615-125836637 GAGCCAAGGAAGGTTTCTGTGGG - Intronic
1090715473 11:129426726-129426748 CAGGCAAGGAAGGATGGAGTTGG - Intronic
1091195136 11:133724372-133724394 GTGGCCAGGCAAGATGCTGCAGG + Intergenic
1091298269 11:134488621-134488643 GAGGCCAGGAAGGCCACTGCAGG - Intergenic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1091875364 12:3929194-3929216 TAGGCAAGGAAGGAATCTGTGGG - Intergenic
1092901892 12:13067533-13067555 GATGCAAGGAAGGATACTTAGGG + Intronic
1096098983 12:48957425-48957447 GAGGGAAGGAAGGAGGGAGCCGG - Exonic
1097629510 12:62042891-62042913 GAGGAAAGGCAGGGTGCTGACGG - Intronic
1100106697 12:91183809-91183831 GAGGGAAGGAAGGAGGCTGGAGG - Intergenic
1103380216 12:120488370-120488392 GAGGCAAGGAAGGCTTTTCCAGG - Intronic
1103939005 12:124491892-124491914 GAGGCACAGAGGGATGCGGCAGG + Intronic
1104301008 12:127565102-127565124 GAGTGAAGGGAGGATCCTGCTGG + Intergenic
1104569528 12:129912669-129912691 GAGGGAAGGAAGGAAGCAGTGGG + Intergenic
1104766056 12:131331052-131331074 GATGGATGGATGGATGCTGCTGG - Intergenic
1105276530 13:18933552-18933574 GAGGACAGGAAGGATCCAGCAGG - Intergenic
1105806611 13:23955183-23955205 GAGGAAAGGGAGGATGGTGAGGG + Intergenic
1106372897 13:29153718-29153740 GAGGAAAAGAAGGATGCAGGAGG - Intronic
1107905743 13:45059505-45059527 GAAGCAAGAAAGGATGTAGCAGG - Intergenic
1108171094 13:47742862-47742884 GAGGCTGGGAAGGATAGTGCAGG + Intergenic
1108466829 13:50725134-50725156 GAGGCAAGGTAGGTCACTGCTGG - Intronic
1108825081 13:54403564-54403586 GAGGGCAGGAAGAATGCAGCAGG - Intergenic
1110568240 13:76977483-76977505 GAGGCAAGGGAGGAAGCTCAGGG + Intergenic
1110608516 13:77461978-77462000 GAGGGAAGGAAGGCAGCTGTGGG - Intergenic
1110774058 13:79385962-79385984 GAGGCCAGTACGGATGCTGGGGG - Intronic
1111289769 13:86150440-86150462 GAGGCAAGGAAGACTTCTGTGGG + Intergenic
1111501760 13:89130584-89130606 GAGGCAAGGAAGTCTTCTGTGGG - Intergenic
1112119875 13:96398230-96398252 GAGACAAGGCAGGATGCTATTGG - Intronic
1112212876 13:97398481-97398503 GAGTCAAGAAAGGATTCTACTGG - Intergenic
1112923752 13:104647994-104648016 CATGCAAGGAATGATTCTGCAGG - Intergenic
1113167881 13:107463427-107463449 GAGGAAGGAAAGGATGTTGCTGG + Intronic
1113259366 13:108544743-108544765 GAGTCTAGGAAGAATGCTGGTGG - Intergenic
1114051079 14:18920291-18920313 GAGGCACGGACGCATGCTGGAGG + Intergenic
1114111480 14:19481631-19481653 GAGGCACGGACGCATGCTGGAGG - Intergenic
1114454468 14:22846145-22846167 GAGAGAAGCAAGGAGGCTGCGGG - Exonic
1116116464 14:40658022-40658044 GAAGCTGGGAAGGATGCTGGAGG - Intergenic
1117794741 14:59380788-59380810 AAGGCAAGGAAGAATGCTGTAGG - Intergenic
1118329227 14:64802759-64802781 GAGGCAGGGAAGCAGGCTGCTGG - Intronic
1118362249 14:65066351-65066373 GAGGCAAGGAGGGTTACTGCAGG - Intronic
1118556425 14:67028029-67028051 GAGGCTGGGAAGGATGGTGTGGG - Intronic
1119553175 14:75531797-75531819 GAGGCAGAGAAGGATGCTTACGG + Intronic
1119668220 14:76499517-76499539 GAAGCCAGGAAGGATGAGGCAGG - Intronic
1119708978 14:76807576-76807598 GAGGCCAGGTGGGAAGCTGCTGG + Intronic
1120022931 14:79550659-79550681 CAGCCAAGGAAGGAAGATGCTGG + Intronic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1121727544 14:96164062-96164084 GAGGCTGGGAAGGATATTGCAGG + Intergenic
1122150634 14:99724352-99724374 GAGGCTTGGATGGATGCTGGAGG - Intronic
1122506528 14:102235186-102235208 GAAGCAAGGGAGCAGGCTGCTGG - Intronic
1122793715 14:104195267-104195289 GAGGCAGGGAAGGGTGGTGCGGG + Intergenic
1122857552 14:104567182-104567204 GAGGCAAGGAAGCCGGGTGCGGG - Intronic
1123018537 14:105386873-105386895 GGGGCAAGGGCGGAGGCTGCTGG - Intronic
1123406576 15:20023013-20023035 GAGGCATGCAAGATTGCTGCAGG - Intergenic
1123515906 15:21029661-21029683 GAGGCATGCAAGATTGCTGCAGG - Intergenic
1123774633 15:23566263-23566285 AAGGAAAGGGAGGATGCAGCCGG - Exonic
1125510848 15:40291605-40291627 GAGGCTATGAAAGAAGCTGCGGG - Exonic
1126107044 15:45153431-45153453 GAGGCAAGAGAGGACGCTGAGGG - Exonic
1126177066 15:45745707-45745729 CAGGGAAGGTAGGTTGCTGCTGG + Intergenic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1129234148 15:74213799-74213821 GGGGGAAGGGAGGCTGCTGCAGG + Intergenic
1129517616 15:76166214-76166236 GGGGAGGGGAAGGATGCTGCGGG + Intronic
1129701215 15:77769592-77769614 GAGGCAAGGATGGAGGCAGGAGG + Intronic
1129782376 15:78281301-78281323 AAGCCAAGGGAGAATGCTGCTGG + Exonic
1129933072 15:79428335-79428357 GAGGCAAGGAGGGATGGGGGAGG - Intergenic
1130038469 15:80383001-80383023 GAGGCTAGGAAGGGTGGAGCAGG + Intronic
1130050602 15:80480588-80480610 GAGCCATGGAAGTATGATGCAGG - Intronic
1130378631 15:83353171-83353193 GATGCAAGGAAGGACTCTCCTGG - Intergenic
1130577674 15:85106749-85106771 GATGAAAGGCAGGCTGCTGCAGG + Intronic
1130812509 15:87394704-87394726 GAGGCAAGAAAGGAAACTGAAGG + Intergenic
1130896529 15:88174432-88174454 GAGGCCAGGAGGGAAGATGCTGG - Intronic
1131117945 15:89805903-89805925 GAGGCAAGGCTGGATTCTGAGGG - Intronic
1131352819 15:91717282-91717304 GAGGGAAGGAAGGATTGTGTGGG - Intergenic
1131423394 15:92326154-92326176 GAGGCAAGGGAGGACTCTGCAGG + Intergenic
1131511424 15:93051411-93051433 GAGGCCAGGAAGGAAGCTGGTGG - Intronic
1131829365 15:96344384-96344406 GAGGCAAGGAGAGATGGGGCGGG - Intergenic
1131836025 15:96392084-96392106 CAGGCAATGAAGGATGGTGATGG + Intergenic
1132708707 16:1257174-1257196 GAGGCCAGGATGGATGGAGCAGG + Intronic
1132852963 16:2033097-2033119 AAAGGAAGGAAGGAAGCTGCTGG - Intronic
1133287976 16:4699331-4699353 CAGGCAGGGCAGGATGTTGCAGG + Intronic
1134037564 16:11042413-11042435 GAGGACAGGAGGGAAGCTGCTGG + Intronic
1134588904 16:15435630-15435652 GAGCCGAGGCAGGAAGCTGCCGG - Intronic
1135260894 16:20979699-20979721 GAGGCAGAGAAGGATGGGGCAGG + Intronic
1135597756 16:23756313-23756335 GGGGGAAGGAAGGTGGCTGCTGG + Intronic
1137669224 16:50269645-50269667 GAGGCAAGGAGCGGTGCTGAGGG - Intronic
1137701502 16:50501214-50501236 GAGGAAGGAAAGGATTCTGCAGG + Intergenic
1137726087 16:50657675-50657697 GAGATAAGGGAGGAGGCTGCAGG - Intergenic
1138486723 16:57349915-57349937 GATGGAAGGAAGGAAGGTGCAGG - Intergenic
1138548068 16:57731131-57731153 GAGGCAAGGAAAGAGGGTGAGGG - Intronic
1141477750 16:84284950-84284972 GAGGATAGGAAGGATGAGGCAGG - Intergenic
1141608448 16:85168799-85168821 GAGCCAGGTAAGGACGCTGCGGG - Intergenic
1142124751 16:88404667-88404689 CAGGCACAGAGGGATGCTGCAGG + Intergenic
1142147951 16:88500248-88500270 GGGGCAAGGAGGGAAGCTTCTGG - Intronic
1142755648 17:2015070-2015092 AAGGCAAGACAGGAGGCTGCTGG + Intronic
1143448090 17:7020353-7020375 GTGGCAAGGAGGGGTGCTGGTGG - Intergenic
1143639377 17:8187038-8187060 GAGGAAAGGATGGATGCAGCTGG - Intergenic
1144052053 17:11505302-11505324 AAGTCCAAGAAGGATGCTGCTGG - Intronic
1144261124 17:13521942-13521964 GAGGGAAGGGAGGTTGCTACTGG - Intronic
1144374802 17:14628287-14628309 AAGGGAAGGAAGGATGGTGGCGG + Intergenic
1145124249 17:20287018-20287040 GAGGCAGGGGAGGCTGCTGACGG - Intronic
1145783825 17:27581401-27581423 GAGGCAAGGGATGAAGCTGGGGG - Intronic
1146270244 17:31480343-31480365 GAGGCAAGCAGGGAGGCAGCAGG + Intronic
1146511081 17:33449265-33449287 GAGGGGAGGAAGGAAGCAGCTGG - Intronic
1147605870 17:41773416-41773438 GAGGAGAGGAAGGAGGCAGCTGG - Intronic
1147987224 17:44313581-44313603 CAGGAACTGAAGGATGCTGCAGG - Intronic
1148353285 17:46956876-46956898 GTGGCAAGAAAGGATGCTAATGG + Intronic
1149019165 17:51943594-51943616 AAAGTAAGGAAGGATGCTCCAGG - Intronic
1149655147 17:58305963-58305985 CAGGCAAGGAAGGCTGCCGAGGG + Intronic
1150636074 17:66914235-66914257 GGGGCAGGGAAGCATGCTGGGGG - Intergenic
1151333269 17:73423757-73423779 AAGGCCTGGAAGGATGCTGGGGG + Intronic
1151691581 17:75689456-75689478 TAGGAAAGGAAGGCTGCTCCTGG - Intronic
1152103323 17:78315218-78315240 GAGGCCAGGCAGGGTCCTGCAGG + Intergenic
1152456923 17:80422010-80422032 GGGGGAGGGAAGGCTGCTGCAGG + Intronic
1152529278 17:80907572-80907594 GAGGCCAGGGAGGAGGCTGATGG - Intronic
1152681036 17:81668044-81668066 GAGGCTTGGAAGGAGGCTGTGGG + Intronic
1153089964 18:1331918-1331940 GAGGTAAGGAAGAATGCTCATGG + Intergenic
1157338094 18:46756195-46756217 GAAGCAAGCAAGGATGCTCTTGG + Intronic
1157505324 18:48222181-48222203 GAGGCTAGGGAGGGTGCAGCAGG - Intronic
1157727784 18:49978182-49978204 GAGGCATGGATGGAGGATGCAGG - Intronic
1158594567 18:58804833-58804855 GAGAGAAGGAAGGAAGCTGTGGG - Intergenic
1159553098 18:69917388-69917410 GAGGGAAGGAAAGATGGTGCTGG - Intronic
1160065322 18:75568531-75568553 GTGGCAGGGAAGCATGGTGCTGG + Intergenic
1160275310 18:77427524-77427546 GAGGCCAGGAAGGGTGGTGGAGG - Intergenic
1160695824 19:483823-483845 GAGGGAAGGAAGATGGCTGCAGG - Intergenic
1161337609 19:3722745-3722767 GAGGCAAGGAAGAAGTCAGCGGG - Intronic
1162450109 19:10749382-10749404 CAGGCAGGGAAGGGTGCAGCTGG - Intronic
1162902867 19:13805632-13805654 GAGGCATGGATGGATGATGGAGG + Intronic
1164521370 19:28982606-28982628 GTGGAAAGGAAGGATGATGGAGG + Intergenic
1164844757 19:31422424-31422446 GATCAAAGGAAGGAGGCTGCTGG - Intergenic
1165306447 19:35005574-35005596 GAGACCAGGGAGGAGGCTGCTGG + Intronic
1165309271 19:35020852-35020874 GAGGCCAGGGAGGAGGCTGCTGG + Intronic
1165334077 19:35156880-35156902 GAGCCCAAGAAGGAGGCTGCTGG + Intronic
1165490288 19:36119469-36119491 GAGGCCAGGGAGGAAGCTGCCGG - Intronic
1166066166 19:40360316-40360338 GAGCCCAGGGAGGAGGCTGCTGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166673174 19:44723647-44723669 GAGGCAGGGAAGGGTGTTCCTGG + Intergenic
1166892082 19:46000036-46000058 GAAGCAAGGATGGAGGATGCAGG + Intronic
1167087453 19:47320100-47320122 GAGGGAGGGCAGGATGCTGCAGG - Exonic
1167656077 19:50765169-50765191 GAGGAAAGAAAGGGTGCTCCAGG + Intergenic
1167686779 19:50961487-50961509 GAGACAAGGATGGAGGCCGCGGG - Intronic
1167882306 19:52470256-52470278 GAGGCAAAGAAGGGTGGTGGGGG - Intronic
1167982098 19:53283993-53284015 GTGGCATGGTAGGATGCTACGGG - Intergenic
1167984048 19:53299980-53300002 GTGGCATGGTAGGATGCTACGGG + Intergenic
1168102353 19:54148040-54148062 GAGGCCAGAGAGGAGGCTGCTGG + Intronic
1168166221 19:54549791-54549813 GAGCCAAGGAGCGGTGCTGCGGG - Intergenic
925641575 2:5990395-5990417 GAGCCAAGAAAGGATGGTGGGGG - Intergenic
925750661 2:7088520-7088542 GAGCCTAGCAAGGATGCTACGGG + Intergenic
926242978 2:11102190-11102212 GAAGCAAAGAAGGCTGATGCTGG + Intergenic
926317555 2:11722238-11722260 AAGGCTAGGAAGGATGGAGCTGG - Intronic
926657822 2:15428386-15428408 GAGTAAAGGAATGATTCTGCAGG + Intronic
927454849 2:23240629-23240651 GAGGGAAGGGAGGATCTTGCAGG - Intergenic
927465182 2:23331540-23331562 GCAGGAAGGAAGGATGCTGGGGG - Intergenic
927487363 2:23497653-23497675 GAGGCAGGGAAAGATGCTCCTGG - Intronic
928445129 2:31327412-31327434 GAGGCAACGGAGGATTCTGGAGG - Intergenic
928943831 2:36754200-36754222 GAGGGAAGGAAGGGTGTTGATGG + Intronic
929037612 2:37709535-37709557 GAGGCAAGGCAGGGTGCTAGGGG + Intronic
929997860 2:46840303-46840325 GAGGCCAGGTAGGAGGCTGTTGG - Intronic
930026773 2:47033881-47033903 GAGGCAGGGAAGGAAGCTCTGGG + Intronic
932365196 2:71147167-71147189 GATGCAAGGAAAGATGCTTACGG - Intronic
932733849 2:74240308-74240330 AAGGCAGGAAAGGAGGCTGCTGG - Intronic
932776643 2:74531805-74531827 CAGGGAAGGAAGGATGTAGCTGG + Intronic
933067618 2:77818190-77818212 GAAGGAAGGAAGGAAGATGCTGG - Intergenic
933159790 2:79010955-79010977 GAATCAAGTAAGGATGCTACTGG - Intergenic
933215910 2:79629717-79629739 GAGGGAGGAAAGGATGCTGAAGG + Intronic
933541147 2:83644176-83644198 GAGGAAAAGAAGGATTCTCCTGG - Intergenic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
934487451 2:94729152-94729174 GAGACAAGGAAGGATGCATCAGG - Intergenic
934650710 2:96089826-96089848 GAGCCAAGCAAGGCTGCTGTCGG + Intergenic
934731457 2:96661271-96661293 GGGAGAAGGAAGGAGGCTGCAGG + Intergenic
935387137 2:102512267-102512289 GAGACAAGTAAGGAGGCTGAGGG + Exonic
935593747 2:104863909-104863931 GAGGCAAGGCCGGAGGCGGCCGG + Intergenic
936941641 2:117890237-117890259 GAGACAAGGAATGAATCTGCAGG - Intergenic
937318397 2:120946612-120946634 GAAGAAAGGGAGGTTGCTGCTGG + Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938716884 2:134028985-134029007 AAGGCAAGGAAGGATGATCTAGG + Intergenic
940212609 2:151271073-151271095 GAGGAAAGGAGGGATGCTCTGGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941132090 2:161663976-161663998 GAGGCAAAGAAACATGATGCTGG + Intronic
942492714 2:176506053-176506075 GAGGCAAGGAAGCATGTTGGGGG + Intergenic
942548638 2:177091548-177091570 GAGGGATTGTAGGATGCTGCAGG - Intergenic
944865616 2:203858453-203858475 GAGGCAAGGAAGAAAGATTCTGG - Intergenic
945752470 2:213804849-213804871 GAGGCCAGATAGGATGCTGGAGG + Intronic
946093639 2:217252786-217252808 AAGACTAGGAAGGAAGCTGCTGG - Intergenic
946202802 2:218080743-218080765 GAGGGAGGGAAGGATGCTGATGG - Intronic
946663024 2:222020996-222021018 GAGCCGAGGAAGGGTGCTGGTGG - Intergenic
947221923 2:227802084-227802106 GAGGCAAGGAAGGATTCCTGTGG + Intergenic
947712525 2:232324181-232324203 GAGGCCATGAAGGCAGCTGCTGG - Intronic
947719919 2:232363996-232364018 GAGGCCATGAAGGCAGCTGCTGG - Intergenic
947731490 2:232433861-232433883 GAGGCCATGAAGGCAGCTGCTGG - Intergenic
948243457 2:236457797-236457819 GAGGCAAGGAAGGGAGCTTCTGG + Intronic
1169195498 20:3680322-3680344 GGGGGAAGGAGGGCTGCTGCAGG - Intronic
1169337369 20:4767499-4767521 GAGGCAAGGATGGGGGCTGGGGG - Intergenic
1169524684 20:6411058-6411080 GAGGCTGGGAAGGATGGGGCAGG + Intergenic
1169939971 20:10926336-10926358 GATGAAAGGAAGGATGGTGGTGG - Intergenic
1170445283 20:16420526-16420548 GTGGAAAGGTAGGAAGCTGCTGG + Intronic
1170605040 20:17869602-17869624 GAGGAAAGGAGGGATGGTGCAGG - Intergenic
1170900931 20:20462456-20462478 GGAGGAAGGAAGGATACTGCAGG - Intronic
1172454007 20:35051954-35051976 GAGGAAAGGAAGGATTGTGATGG - Intronic
1172556831 20:35849452-35849474 GAGGCAGGGCAGGATGGTGCAGG + Intronic
1172670350 20:36630720-36630742 GAGGCAAAGAGGGATGTTGAAGG - Intronic
1172806642 20:37616612-37616634 GAGGCCAGCATGGCTGCTGCTGG + Intergenic
1173254063 20:41380930-41380952 GGGGCAGGGAGGGATTCTGCAGG + Intergenic
1173480956 20:43399030-43399052 GAGGCATGGAAGGAGGTTGTGGG - Intergenic
1174167480 20:48595409-48595431 GAAAAAAGGAAGGAAGCTGCAGG + Intergenic
1174397986 20:50259767-50259789 GGGGCAGGGAAGGAAGCTGTGGG - Intergenic
1174730772 20:52914886-52914908 GAGGTAAGGACAGATGCTGGGGG - Intergenic
1174768230 20:53273660-53273682 GAGGCCAGCAAGGAGGCTGTTGG + Intronic
1175027861 20:55921828-55921850 GAAGTTAGGAAGGATGCTGGGGG - Intergenic
1175328160 20:58143933-58143955 GAAGAAAGGAAGCCTGCTGCTGG - Intergenic
1175364991 20:58447022-58447044 GAGCCTAGGGAGGATGCCGCTGG + Exonic
1175520535 20:59599888-59599910 GGGGCAAGGGAGGAAGCAGCAGG - Intronic
1175789249 20:61731328-61731350 GCGGTCAGGAAGGGTGCTGCGGG - Intronic
1176136324 20:63523568-63523590 GAGGCAGGGGACGATGCCGCGGG - Intergenic
1176383214 21:6124039-6124061 GGGGTAAGGATGGATGGTGCCGG - Intergenic
1178003275 21:28188474-28188496 GATGCTAGGAAGGGTACTGCGGG - Intergenic
1178350518 21:31870058-31870080 AAGGGAAGGAAGGAAGCAGCTGG + Intergenic
1179071420 21:38074896-38074918 AAGGCAACGATGGATGCTGGTGG + Intronic
1179740253 21:43414200-43414222 GGGGTAAGGATGGATGGTGCCGG + Intergenic
1180469554 22:15642666-15642688 GAGGCACGGACGCATGCTGGAGG + Intergenic
1180701260 22:17782602-17782624 TAGGAAAGGAAGGATGCCACGGG - Intergenic
1180710467 22:17836027-17836049 GAGACAAGGAGGGATTTTGCTGG - Intronic
1182720960 22:32399653-32399675 GGAGTACGGAAGGATGCTGCAGG - Exonic
1183421439 22:37713826-37713848 GAGGAAAGGGAGCAGGCTGCGGG + Intronic
1183445723 22:37853050-37853072 GAGGCAAGAACTGAGGCTGCTGG - Intronic
1183786018 22:40029683-40029705 GAGGCCAGGACGGAGGCTGCAGG - Exonic
1183971643 22:41482032-41482054 AAGGGAAGAAAGGATGCTGCTGG - Intronic
1184525315 22:45019292-45019314 GAGGGAAGCAAGGAGCCTGCAGG - Intergenic
1185019697 22:48366961-48366983 CACCCAAGGAAGGCTGCTGCTGG - Intergenic
1185064975 22:48627654-48627676 GAGCCAAGAAAGGAGGCTGCTGG - Intronic
950663135 3:14479322-14479344 GAGGGGAGGAAGGCTGCTCCAGG + Intronic
950888467 3:16381676-16381698 AAGGCAAGGAAGGATCATGATGG + Intronic
952839338 3:37630938-37630960 GAGGCAGGGCAGGAAGCTGATGG + Intronic
952908315 3:38159101-38159123 GAGGGAAGGTAGGATGATTCTGG - Intergenic
952953807 3:38544234-38544256 GAGGAAAGGAGGGAAGCTGGAGG - Intergenic
954756017 3:52840411-52840433 AGGGTAAGGAACGATGCTGCGGG + Exonic
954927820 3:54252751-54252773 GAGCACAGGAAGCATGCTGCAGG - Intronic
954992162 3:54850814-54850836 GAGATGAGGAAGGATGCTGTAGG + Intronic
956527505 3:70181155-70181177 GAGGAAAGGAGCAATGCTGCTGG - Intergenic
957656326 3:83081743-83081765 GTGTCAAGGAAGGATCCTGGTGG - Intergenic
961010678 3:123433746-123433768 GAGGGAAGGGAGGAGGCTGCTGG - Intronic
962492521 3:135908295-135908317 GAGGCAAGCAGGCATTCTGCAGG - Intergenic
964075250 3:152684812-152684834 GAGGCCAGGAGTGATGCTGAGGG - Intergenic
964212668 3:154245722-154245744 AAGGAAAGGAAGGATGTAGCAGG - Intronic
964728447 3:159839684-159839706 GTGGGTAGGAAGGATGATGCCGG + Intronic
965754799 3:172014792-172014814 GAGGCAAGGAAGGGTACTGGAGG + Intergenic
966842895 3:184103853-184103875 GAGGAAAGGAAGGAAGGAGCTGG + Intronic
967109929 3:186284234-186284256 TGTGCAAGGAAGGAGGCTGCTGG - Intronic
967938086 3:194745376-194745398 GAGGCAGCGAGAGATGCTGCTGG + Intergenic
968619505 4:1597451-1597473 GAGCCCAGGAACCATGCTGCTGG + Intergenic
968964507 4:3763213-3763235 GGGGCGAGGAAGGAGGGTGCTGG - Intergenic
969100333 4:4763665-4763687 GCGGCTAGGAAGGAGGCAGCAGG - Intergenic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969337567 4:6520643-6520665 GAGGTGAGGAAGGCTGCTGTTGG - Intronic
969411777 4:7033335-7033357 CACGCCAGGAAGGGTGCTGCAGG - Intergenic
969480739 4:7445615-7445637 GAGGCCAGGATGGGGGCTGCAGG + Intronic
969515712 4:7647095-7647117 GAGGGAAGTAGGGATGCTCCAGG + Intronic
973227700 4:47804707-47804729 GAGGCTGGGAAGGATGGTGGGGG + Intronic
973553643 4:52060070-52060092 GAGCCAAGAGAGGATGCTGAGGG - Intronic
973812046 4:54581064-54581086 GAGGTGAGGAAGGATTCTGCTGG + Intergenic
973982358 4:56316682-56316704 GAGGAAAGGTAGGTAGCTGCAGG + Exonic
974501427 4:62709057-62709079 GTGGCAAGGGAGGGTGCTGGTGG + Intergenic
975047814 4:69826167-69826189 GAGGGAAGGAAGGAATCTCCAGG - Intronic
975184937 4:71390465-71390487 GTGGCAAAGAAGGATGCTAAAGG - Intronic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
975714787 4:77195245-77195267 GGGGCAGGGAAGGCTCCTGCAGG + Intronic
976124090 4:81815005-81815027 GAGGAAAGGAGGGATGTGGCGGG + Intronic
977425328 4:96861463-96861485 GAGACAAGCTTGGATGCTGCAGG + Intergenic
978687682 4:111466859-111466881 AAGGCAAGGAAGGAGGCTCATGG + Intergenic
980189425 4:129504449-129504471 GAGGTAAGCAAAGAGGCTGCAGG + Intergenic
981305366 4:143241466-143241488 GAGGAAAGGAAGAATGCAGGAGG - Intergenic
981940917 4:150280781-150280803 GAGGCGAGGAAGGAAGCCACAGG - Intronic
982889578 4:160831058-160831080 GAAGCAAGGAAGTCTTCTGCGGG + Intergenic
983595046 4:169457052-169457074 GAGGCTAGGAAGGGTGGTGGTGG + Intronic
984188861 4:176580639-176580661 GAGGCTGGGAGTGATGCTGCAGG - Intergenic
984787862 4:183585428-183585450 GAGGCAAGGAAGGAGGGAGATGG + Intergenic
984947754 4:184983199-184983221 GAGGCAAGGAAGTCTGTTGGTGG - Intergenic
985744310 5:1637723-1637745 GAGGCTAGGAACCATGCTGGAGG - Intergenic
985969556 5:3364274-3364296 AAGGGAGGGAAGGATGATGCAGG + Intergenic
987196685 5:15533876-15533898 GAGGCAAAGAAGGATGCTTTGGG + Intronic
989272749 5:39552060-39552082 GAGGAAAGGAAGGAGGATGTAGG - Intergenic
989744121 5:44807524-44807546 GAACCAAGGAAGGAGGCTGTGGG - Intergenic
991299859 5:65119825-65119847 GAGGGAAGGAAGGAGGTAGCAGG - Intergenic
991447730 5:66717897-66717919 GAGGGAAGGAAGGAGGCCGTGGG + Intronic
993098576 5:83508916-83508938 GAGGCAAGGAGGATTGCTGGAGG + Intronic
993987893 5:94618862-94618884 GAGGCTAGGAAGGAAGCGGCTGG + Intronic
994514025 5:100746951-100746973 GAGGCATGTAGGGTTGCTGCAGG + Intergenic
994766870 5:103929405-103929427 GAGGCAAGGGAGAATAGTGCAGG + Intergenic
995478957 5:112576378-112576400 AAGGCAAGCCAGGAGGCTGCTGG + Intergenic
995555952 5:113328942-113328964 AAGGGAAGGAGGGATGCTGCAGG - Intronic
996572008 5:124941851-124941873 GAGGTGAGGAAGAATGCTGGAGG + Intergenic
997695124 5:135855566-135855588 GAGGCATGGGAGGTTTCTGCAGG + Intronic
998676133 5:144410016-144410038 GAGGAGGGGAAGGATGCTCCAGG + Intronic
998731221 5:145079815-145079837 TAGGCAAGGAACGAATCTGCAGG - Intergenic
999204643 5:149839421-149839443 CAGGCAAGGAAGGCTGCAGGTGG + Intronic
1000649229 5:163795620-163795642 GAAGAAAGTCAGGATGCTGCAGG - Intergenic
1001150548 5:169223875-169223897 GAGGGAAAGGAGGAGGCTGCAGG + Intronic
1001174146 5:169449616-169449638 GAGGCAAGGAAAAGTGTTGCTGG - Intergenic
1001241689 5:170076130-170076152 GGGGCAGGGAAGCATGCTGGAGG + Intronic
1001469193 5:171997204-171997226 GAGGTGAGGAATGCTGCTGCAGG - Intronic
1001700696 5:173704812-173704834 GAGGCAATGAAGGAGGCTGGAGG + Intergenic
1001739597 5:174041189-174041211 GAGGCCAGGAGAGAAGCTGCAGG - Intergenic
1002147656 5:177197930-177197952 CAGAGAAGGGAGGATGCTGCAGG + Intronic
1002169764 5:177368396-177368418 GAGACAAGTAAGGAGGCTGAAGG - Intronic
1002210570 5:177596533-177596555 AAGGAGAGGAAGGATTCTGCTGG + Intergenic
1002616947 5:180461825-180461847 GTGGAAATGAAGGATGCTCCAGG + Intergenic
1002720767 5:181260285-181260307 GGGGCAAGGAAGGAGGCGGGTGG + Exonic
1003131465 6:3398665-3398687 GAGGCAGGGAGGGTTGCAGCTGG - Intronic
1005948157 6:30610227-30610249 CATCCTAGGAAGGATGCTGCTGG - Intronic
1006294412 6:33163701-33163723 GAGGCGGGGAGGGGTGCTGCTGG - Exonic
1006411475 6:33876496-33876518 GAAGCAATGCAGGATGCTGAGGG - Intergenic
1006453741 6:34120371-34120393 GAGGCAAGGAAGGCAGGTGAGGG + Intronic
1006593348 6:35174113-35174135 GAGGCAAGGAAGGCAGGGGCAGG + Intergenic
1006717983 6:36132184-36132206 CAGGCAAGGATGGATGTGGCTGG + Intronic
1006903113 6:37515757-37515779 GAAAGAAGGGAGGATGCTGCCGG - Intergenic
1011083238 6:83512001-83512023 GAGGCAGCGCAGGATGCTCCCGG + Intergenic
1012221281 6:96652223-96652245 GAGGCAAGAAAGGAAACTGTTGG + Intergenic
1012948070 6:105488893-105488915 GAGGCAATGAAAGATGTTGGCGG + Intergenic
1014160305 6:118160032-118160054 GAGTAAAGGCAGGATGCTGAGGG + Intronic
1016116777 6:140296160-140296182 GAGGCAGGGAAGGATGTAGCAGG + Intergenic
1018240927 6:161773920-161773942 GAGGAAGGGAGTGATGCTGCTGG + Intronic
1018433875 6:163744249-163744271 GAGGCAAGGAGGGAGGCCTCAGG - Intergenic
1018742686 6:166742633-166742655 GTTGCTGGGAAGGATGCTGCAGG - Intronic
1018875143 6:167815775-167815797 GAGGCAAGGAAAGACGGGGCTGG + Intergenic
1019565467 7:1676668-1676690 GAGACAGGGAAGGAGGATGCTGG + Intergenic
1019843064 7:3468663-3468685 GAGGCCAGGAAGAATCCTGCTGG + Intronic
1020895459 7:13933540-13933562 GAGGAAAGGAAGCAGGGTGCAGG + Intronic
1021529369 7:21626601-21626623 TAGGCAAAAATGGATGCTGCTGG - Intronic
1021746970 7:23751026-23751048 GAGGCTAGGAAGGATGTGGTAGG - Intronic
1022056021 7:26735101-26735123 GAGAGAGGGAAGGATGCTGTGGG - Intronic
1022610025 7:31861706-31861728 TGGACTAGGAAGGATGCTGCTGG - Intronic
1022972437 7:35530263-35530285 CAGGCAAGCAGGGGTGCTGCGGG + Intergenic
1023622024 7:42083191-42083213 GAGGCTAGGAAGGATAGTGGGGG - Intronic
1023724360 7:43126928-43126950 GAGGCAAGGAAGAAGGATGAGGG - Intronic
1023744007 7:43304992-43305014 GAGGCCAGAGAGGAAGCTGCGGG + Intronic
1028521209 7:91733183-91733205 GAGGCTGGGAAGGGTGTTGCAGG - Intronic
1029210237 7:98901993-98902015 TAGTCAAGGAAGGCTGCTGATGG - Intronic
1032217452 7:129968747-129968769 GAGCCACAGAAGGATGCAGCCGG - Intergenic
1032220124 7:129988156-129988178 GAGGCGAGGAAGGATGGGGAAGG + Intergenic
1034558941 7:151867383-151867405 GAGGCAAGGAAGGATCCTCCCGG - Intronic
1034990031 7:155542388-155542410 GAGCCAAGGAAGGAAGGTCCTGG + Intergenic
1035021673 7:155804253-155804275 GAGGCGCGGCAGGGTGCTGCGGG - Intronic
1035850993 8:2919180-2919202 GGGGCCTGGGAGGATGCTGCAGG - Intergenic
1036058024 8:5281540-5281562 GAGGAAACGATGGATACTGCAGG + Intergenic
1036288013 8:7461907-7461929 GAGGTTGGGTAGGATGCTGCAGG + Intronic
1036333463 8:7849621-7849643 GAGGTTGGGTAGGATGCTGCAGG - Intronic
1037535453 8:19818771-19818793 GAGTAAAGGAAACATGCTGCAGG - Intronic
1037641681 8:20750062-20750084 GAGGCAAGAAAGGACTCTTCTGG + Intergenic
1038765474 8:30423757-30423779 GAAGAAAGGCAGGATGGTGCGGG + Intronic
1039133419 8:34293629-34293651 TAGGCAAGGAGAGATGCTGGAGG + Intergenic
1039172540 8:34764299-34764321 GAGGGAAGGAAGGATTCTGGAGG + Intergenic
1043537954 8:81226746-81226768 CAGGCAAGGAAGGAAGATGGTGG - Intergenic
1045430915 8:102114465-102114487 AAAGCAATGAAGGATGATGCAGG + Intronic
1045918099 8:107497566-107497588 GAGGCACGGAAGGAGTGTGCTGG - Exonic
1047295040 8:123563208-123563230 GAGTCTAGTGAGGATGCTGCTGG + Intergenic
1047431905 8:124800046-124800068 GAAGCAGGGAAGGAGGGTGCTGG - Intergenic
1048580878 8:135729075-135729097 GGGGCAAGGATGGCTGCTGAGGG - Intergenic
1048884889 8:138902052-138902074 GACGCTGTGAAGGATGCTGCAGG + Intronic
1049326299 8:142023245-142023267 CAGACAAAGAAGGAGGCTGCTGG - Intergenic
1049347843 8:142148175-142148197 GAGGCAAAGCGGGAGGCTGCAGG + Intergenic
1049487041 8:142871154-142871176 CAGGCCCTGAAGGATGCTGCTGG + Intronic
1049848396 8:144816763-144816785 GAGGCTAGGAAGGATGGGGTGGG + Intergenic
1050578117 9:7020956-7020978 GAGGCTAGGAAGGGTGGTGGGGG - Intronic
1051158662 9:14180847-14180869 TAGGCAAGCAAAGAGGCTGCTGG - Intronic
1053670354 9:40355278-40355300 GAGACAAGGAAGGATGCATCAGG + Intergenic
1053920144 9:42981541-42981563 GAGACAAGGAAGGATGTATCAGG + Intergenic
1054381474 9:64495263-64495285 GAGACAAGGAAGGATGCATCAGG + Intergenic
1054514258 9:66021022-66021044 GAGACAAGGAAGGATGCATCAGG - Intergenic
1057546303 9:96022014-96022036 GAGGAAGGGAAGGCAGCTGCAGG - Intergenic
1057858938 9:98624628-98624650 CAGCCAAGGAAGCAAGCTGCAGG + Intronic
1057891890 9:98875846-98875868 GAGGAAAGAGAGGATGCTCCAGG + Intergenic
1059183221 9:112239879-112239901 GAGGCAAGGAAGGATCGATCAGG + Intronic
1060423542 9:123486483-123486505 GAGGCCAGGAAGGAAGCAGCTGG + Intronic
1060519997 9:124288887-124288909 GGGGCAATGAAGGGGGCTGCAGG - Intronic
1060679242 9:125546724-125546746 CAGGAAAGGAAGGGTGCTCCTGG + Intronic
1060927803 9:127467446-127467468 GAGGGAGGGAAGGGGGCTGCAGG + Intronic
1061049000 9:128183129-128183151 GAGGGAGGGAGGGAGGCTGCAGG - Intronic
1061627277 9:131848494-131848516 GAGGGAAGGCAGGCTGCCGCTGG + Intergenic
1061998688 9:134204790-134204812 GTTGCAGGGAAGGAGGCTGCAGG - Intergenic
1062152777 9:135030428-135030450 GAGGCAGAGAGGGGTGCTGCGGG + Intergenic
1062439763 9:136564457-136564479 GGGGCAAGGCAGGAGGCTGCGGG - Intergenic
1062501747 9:136854755-136854777 GAGACCAGGAAGGAGCCTGCGGG - Exonic
1062601625 9:137320984-137321006 GTGGCAAGGAAGTGTGCTCCAGG - Intronic
1062669230 9:137696868-137696890 GAGGAAAGGAAGGAAGACGCAGG - Intronic
1185834169 X:3329441-3329463 GAGGGAAGGAAGGAAGATGAAGG + Intronic
1187425647 X:19175309-19175331 GAGGGAAGGAAGGATGACTCCGG - Intergenic
1187662099 X:21560045-21560067 TGGGCAAGGAGGGAAGCTGCAGG + Intronic
1189255703 X:39637296-39637318 CAGCCAAGCAAGGAAGCTGCGGG + Intergenic
1190282389 X:48939637-48939659 GAGGCCAGGAAGGAGGTTGGTGG - Intronic
1192493896 X:71600967-71600989 GAGGCAGGGAAGGATAGTGGAGG - Intronic
1197354859 X:125425895-125425917 GAGGCTGGGAAGGATGGTGGGGG + Intergenic
1197749226 X:129953312-129953334 GAGGCCCGGAAGGATGCTTCGGG - Intergenic
1198297361 X:135300872-135300894 GAGGGAGGGAAGGATGAGGCAGG + Intronic
1199367862 X:147008187-147008209 GAGGCTAGGAAGGATAATGGGGG - Intergenic
1199949800 X:152698822-152698844 GAGGCAAGGTAAGACGCTGAGGG + Exonic
1199954626 X:152733852-152733874 GAGGCAAGGTAAGATGCCGAGGG + Exonic
1199959874 X:152769639-152769661 GAGGCAAGGTAAGACGCTGAGGG - Exonic
1200017926 X:153180043-153180065 GAGGCAAGGTGAGATGCTGAGGG + Intronic
1200153925 X:153965259-153965281 GGGGCAGGGAGGGATGCTGGTGG - Intronic
1200243309 X:154508819-154508841 GAGAAAAGAAAGGATGCTGAGGG + Intronic