ID: 1071832034

View in Genome Browser
Species Human (GRCh38)
Location 10:89381414-89381436
Sequence CCCCACACACAGGTTTCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071832025_1071832034 5 Left 1071832025 10:89381386-89381408 CCTCACCCAGCATATGTCCCACA No data
Right 1071832034 10:89381414-89381436 CCCCACACACAGGTTTCATTGGG No data
1071832021_1071832034 15 Left 1071832021 10:89381376-89381398 CCTGACCCCACCTCACCCAGCAT 0: 1
1: 0
2: 8
3: 66
4: 539
Right 1071832034 10:89381414-89381436 CCCCACACACAGGTTTCATTGGG No data
1071832022_1071832034 10 Left 1071832022 10:89381381-89381403 CCCCACCTCACCCAGCATATGTC 0: 1
1: 0
2: 3
3: 17
4: 306
Right 1071832034 10:89381414-89381436 CCCCACACACAGGTTTCATTGGG No data
1071832026_1071832034 0 Left 1071832026 10:89381391-89381413 CCCAGCATATGTCCCACACACAC 0: 1
1: 0
2: 0
3: 32
4: 190
Right 1071832034 10:89381414-89381436 CCCCACACACAGGTTTCATTGGG No data
1071832024_1071832034 8 Left 1071832024 10:89381383-89381405 CCACCTCACCCAGCATATGTCCC 0: 1
1: 0
2: 2
3: 38
4: 446
Right 1071832034 10:89381414-89381436 CCCCACACACAGGTTTCATTGGG No data
1071832023_1071832034 9 Left 1071832023 10:89381382-89381404 CCCACCTCACCCAGCATATGTCC 0: 1
1: 0
2: 1
3: 20
4: 206
Right 1071832034 10:89381414-89381436 CCCCACACACAGGTTTCATTGGG No data
1071832027_1071832034 -1 Left 1071832027 10:89381392-89381414 CCAGCATATGTCCCACACACACC 0: 1
1: 0
2: 0
3: 20
4: 170
Right 1071832034 10:89381414-89381436 CCCCACACACAGGTTTCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071832034 Original CRISPR CCCCACACACAGGTTTCATT GGG Intronic
No off target data available for this crispr