ID: 1071832978

View in Genome Browser
Species Human (GRCh38)
Location 10:89390669-89390691
Sequence TGGGCTAAACAAACCCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071832978_1071832983 19 Left 1071832978 10:89390669-89390691 CCCTCATGGGTTTGTTTAGCCCA 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1071832983 10:89390711-89390733 TCTGAATACCTAATCAGCCTGGG No data
1071832978_1071832982 18 Left 1071832978 10:89390669-89390691 CCCTCATGGGTTTGTTTAGCCCA 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1071832982 10:89390710-89390732 TTCTGAATACCTAATCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071832978 Original CRISPR TGGGCTAAACAAACCCATGA GGG (reversed) Intronic
901411032 1:9084292-9084314 TTGGTTAAAGAAACCCATAAAGG + Intronic
904111837 1:28132154-28132176 TTGGTTAAAGAAACCCATAAAGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
908406227 1:63816625-63816647 GAGGCTAAAGAAACCCATGCTGG - Intronic
908960718 1:69694037-69694059 TGGGATTATCAAACCCAGGAAGG - Intronic
911477652 1:98393088-98393110 TGGCCTAAGCAAAACCATAATGG + Intergenic
912460158 1:109825121-109825143 ACTGCTAAACAACCCCATGATGG + Intergenic
916584500 1:166138589-166138611 TGGGCTAAAAAAACCTAACAAGG + Intronic
916889285 1:169100896-169100918 TTGGCTCAAAAAAGCCATGAAGG + Intergenic
917970893 1:180206786-180206808 TGTGCTAAGCACTCCCATGAAGG - Intergenic
919596980 1:199576570-199576592 TGGGCTAAATTAGCCTATGATGG - Intergenic
921193950 1:212734573-212734595 TGGGCAAAACTAAGCCATGGTGG - Intronic
1066036247 10:31489438-31489460 TGGCCTAAACAAACCAATTAAGG - Intronic
1067294369 10:44966549-44966571 TTGGTTAAAGAAACCCATAAAGG - Intronic
1069250652 10:66262055-66262077 TGGGCAAAAAAAACCTATTATGG + Intronic
1071457007 10:85858564-85858586 TCTGGAAAACAAACCCATGATGG + Intronic
1071473273 10:86002798-86002820 TGGAATAAACAAACCAATGGAGG - Intronic
1071746369 10:88424073-88424095 TGTGGTAATCAAAGCCATGAAGG - Intronic
1071832978 10:89390669-89390691 TGGGCTAAACAAACCCATGAGGG - Intronic
1073281584 10:102358438-102358460 TGGGCAAAACAAACCCTCTATGG - Intronic
1074312144 10:112331140-112331162 TTGGTTAAAGAAACTCATGAAGG + Intergenic
1075514000 10:123094928-123094950 TGGGCTCTACAAGCCCATCAGGG + Intergenic
1076369261 10:129941207-129941229 GGGACGAAAGAAACCCATGATGG + Intronic
1077378990 11:2219425-2219447 TGGGCTCAGCAAAGCCATGGGGG - Intergenic
1082215033 11:49558830-49558852 GGGGCTAAAAAGACCCAGGAGGG + Intergenic
1083610286 11:64001042-64001064 TCGGATAAACAAGCCCATGCGGG - Intronic
1085468903 11:76744244-76744266 TGGGCTCAGCAAACCCACGTGGG + Intergenic
1085945726 11:81269986-81270008 TGTGATAAACAAACCCAAGACGG + Intergenic
1086634544 11:89065639-89065661 GGGGCTAAAAAGACCCAGGAGGG - Intronic
1090586793 11:128221859-128221881 TGGGGTAAACAAAGACATGGAGG - Intergenic
1092815118 12:12305939-12305961 TCGGTTAAATAAACCCATGAAGG - Intergenic
1093920271 12:24851576-24851598 TGGCCACAACAAACCTATGATGG + Intronic
1101161018 12:101976525-101976547 AGGGCTAGACAAAATCATGAGGG + Intronic
1101185050 12:102267288-102267310 TGGGCTAACCATACCTCTGAGGG - Intergenic
1107043226 13:35970517-35970539 TGCATTAAACACACCCATGAGGG - Intronic
1108112903 13:47095844-47095866 TTGGTTAAAGAAACCCATAAAGG + Intergenic
1109021100 13:57094232-57094254 TGCACTCAACAAAGCCATGAAGG + Intergenic
1110396388 13:75034309-75034331 AGAGCTTAACAAACCCATAAGGG - Intergenic
1110720750 13:78758860-78758882 TTGGTTAAAGAAACCCATAAAGG + Intergenic
1112812568 13:103235193-103235215 TGTGCTAATCAAACCTGTGAGGG + Intergenic
1114255103 14:20994999-20995021 AGGGATAAAGAAACCCATGAAGG - Intronic
1116736888 14:48702554-48702576 TGGGCTTATCAAACCAGTGATGG - Intergenic
1118226698 14:63907325-63907347 TGCTCTAAACCAACACATGATGG - Intronic
1119764027 14:77176845-77176867 TAGGCTCAACAAAACTATGAGGG + Intronic
1119911774 14:78356135-78356157 AGGGCCAACCAAGCCCATGAAGG - Intronic
1121923750 14:97908448-97908470 TGTGCCAAACAAACCCCTAAAGG - Intergenic
1123192298 14:106583020-106583042 TGGGCCAAACCCACCCATCAGGG - Intergenic
1125166990 15:36718219-36718241 TGGTATAGACAAACCGATGATGG - Intronic
1126664536 15:51064415-51064437 TGGACTAAACAAAACTATGCAGG - Intronic
1130353523 15:83110685-83110707 TGGGCTGAAGAATCCCATGAGGG - Intronic
1132768150 16:1545387-1545409 TGGGCAAAACAGACCCGTTAGGG - Intronic
1133402105 16:5495822-5495844 TTGGCTAAAGAAACCCATTAAGG + Intergenic
1133548257 16:6828872-6828894 TTGGCTAAAGAAACACATAAAGG + Intronic
1134292783 16:12915872-12915894 TGATCTAAATAAACACATGATGG + Intronic
1137232069 16:46575710-46575732 AAGGCTGAGCAAACCCATGATGG + Intergenic
1137411720 16:48234125-48234147 TGGTGTAAACACACCCATCATGG + Intronic
1138525009 16:57600185-57600207 TGGGCTGGACAAACTCAAGAAGG + Intergenic
1141398437 16:83725231-83725253 TGGGATAAACAAAGGCATGGTGG + Intronic
1143506778 17:7370484-7370506 TGGGCTGAATAAAACCATGAAGG - Intergenic
1150951919 17:69812570-69812592 TTGGTTAAACAAACCCATAAAGG + Intergenic
1150953370 17:69826952-69826974 TGGGTTAAACAGAGACATGATGG - Intergenic
1151137856 17:71964942-71964964 TGGGCTGAAAATACCCAGGATGG + Intergenic
1151540479 17:74762250-74762272 TGGGCTAATCAAGCCCATGATGG - Intronic
1152967800 18:132680-132702 TGGACTAAACTAATCCAAGATGG + Intergenic
1153019115 18:610930-610952 TGGGCTCACCCAACCCATGTTGG - Intronic
1157087602 18:44597610-44597632 TTGGTTAAAGAAACCCATAAAGG - Intergenic
1161434470 19:4254468-4254490 GGAGCTGAACAACCCCATGAAGG + Exonic
1165734240 19:38165670-38165692 TGGGCTGAACAAGCCTTTGAGGG - Intronic
1166511232 19:43410295-43410317 TGGGGTAAACAAATGCATGGGGG + Intronic
925886163 2:8395083-8395105 TGGTCCAGACAACCCCATGAGGG + Intergenic
929723078 2:44391497-44391519 TGGGCAAAGCATACCAATGATGG + Intronic
930549869 2:52819987-52820009 TGGGCTAAAAGAAACCATGGCGG + Intergenic
932650093 2:73546056-73546078 TCTGCTCAAGAAACCCATGAGGG - Intronic
935458429 2:103298398-103298420 TTGGCTATAGAAACCAATGATGG + Intergenic
935787551 2:106562650-106562672 TGGTCAAAACACAGCCATGAAGG + Intergenic
937323727 2:120976489-120976511 TGGGGTAAACAAGCCCTAGATGG + Intronic
940112335 2:150168567-150168589 TCTGCTAAACAAAACCATGTGGG + Intergenic
940509305 2:154592603-154592625 TGGGTTGAAGAAACCCATAAAGG - Intergenic
942344076 2:174983418-174983440 TGGGCCAAAAAAACCCAGGGAGG + Intronic
948578471 2:238969024-238969046 GGGCTTAAACAAACCCATCAGGG - Intergenic
1168978041 20:1982741-1982763 TGGCCTAAGTGAACCCATGATGG + Intronic
1171237165 20:23536354-23536376 TTGGTTAAAGAAACCCATAAAGG - Intergenic
1173021247 20:39269532-39269554 TGGGGTATACAAGCCCCTGAAGG + Intergenic
1173287676 20:41687899-41687921 TGGGCCACTCAAACCCATAATGG + Intergenic
1174313495 20:49678232-49678254 TGGGCTAAACTAAAAGATGAAGG + Intronic
1177929852 21:27267359-27267381 TTGGTTAAAGAAACCCATAAAGG - Intergenic
1178229363 21:30763633-30763655 TGGTTTATACAAACCTATGAAGG - Intergenic
1178629460 21:34246587-34246609 TGGCCTAAGCAAAGCCGTGATGG + Intergenic
1181158324 22:20939652-20939674 TGGGCTAGGCAAACACAAGAAGG - Intronic
1184778813 22:46636029-46636051 GGGGCTAAACGTCCCCATGAAGG - Intronic
950048975 3:9971654-9971676 TGGGCTAAACAAAAACTTCATGG - Intronic
953356581 3:42261463-42261485 TGTGCCAAACAAACCCAGGAGGG - Intronic
958193143 3:90208993-90209015 TGGGAAAAACAAAGCAATGATGG - Intergenic
958962760 3:100525746-100525768 GGGGAGAAACAGACCCATGAAGG + Intronic
959007683 3:101039042-101039064 TGGTCTAAACAAACCAAGAATGG - Intergenic
961243541 3:125432699-125432721 TTGGTTAAAGAAACCCATAAAGG + Intergenic
963674131 3:148287067-148287089 TGGGATAAACTTACCCATCAAGG - Intergenic
964946933 3:162236656-162236678 TTGGCTAAATGAACCCAGGATGG + Intergenic
965470559 3:169085153-169085175 TTTGCCAAACACACCCATGAAGG - Intronic
969331514 4:6475891-6475913 TGGGTTAGACAAGGCCATGAGGG + Intronic
970594763 4:17590107-17590129 TAGGTTAGAGAAACCCATGAGGG + Intronic
971415463 4:26423389-26423411 TGAGCTAAACAGACTGATGACGG + Intronic
972956230 4:44395591-44395613 TTGGTTAAAGAAACCCATAAAGG + Intronic
974914369 4:68161464-68161486 AGTGCTCAACAACCCCATGAAGG + Intergenic
975433617 4:74324092-74324114 TTGGTTAAAGAAACCCATAAAGG + Intergenic
975851123 4:78573695-78573717 TTGGTTAAAGAAACCCATAAAGG - Intronic
983830861 4:172326641-172326663 TAGTCTAAACAAACTCATAAAGG - Intronic
986326776 5:6681559-6681581 AGGGTTAAACAAGGCCATGAAGG - Intergenic
987874460 5:23662338-23662360 TGGGCTATGCAGACCCAGGAAGG - Intergenic
987988475 5:25180582-25180604 TAAACTAAACAAACTCATGAAGG - Intergenic
989829629 5:45899394-45899416 TGGGCTAAATAAGTACATGATGG - Intergenic
991053476 5:62297154-62297176 TGGTCTCAGCAAACCCATGAAGG - Intergenic
994984916 5:106919915-106919937 TGGACTTAAGAAAGCCATGAAGG - Intergenic
997723509 5:136100555-136100577 TGAAATAAACAAACACATGAAGG - Intergenic
998586940 5:143437382-143437404 TGGGTTAAACAAACCAACCAAGG - Intergenic
998940682 5:147279656-147279678 TTGGTTAAAGAAACCCATTATGG - Intronic
999272360 5:150304007-150304029 TGGGCTAAACAAAACCAGTTAGG + Intronic
1000450939 5:161386164-161386186 TGGTTTAAATAAATCCATGAGGG - Intronic
1005357591 6:24999418-24999440 TTGGTTAAAGAAACCCATGAAGG + Intronic
1005567585 6:27112442-27112464 TAGGCTACCCAAACCCATAATGG - Intergenic
1007217194 6:40249542-40249564 TAGGCTAAAGAAATCCATGCTGG + Intergenic
1008682313 6:53885806-53885828 TAGGCAAACCAAACACATGATGG - Intronic
1009899272 6:69792112-69792134 TTGGATAAAGAAACCCATAAAGG + Intronic
1010909070 6:81530716-81530738 TGTACTAAATAAACACATGAGGG + Intronic
1013898171 6:115118195-115118217 TGTGATAAAGAAAGCCATGATGG + Intergenic
1014251112 6:119116375-119116397 TGGGCTAAAGGACCCCATGTTGG + Intronic
1015071904 6:129104745-129104767 GGGGCCAAACCAAACCATGAAGG - Intronic
1018993447 6:168692312-168692334 TGGGCAAGAGAAACCCATGGAGG - Intergenic
1021143593 7:17057395-17057417 TGGCCTAAACAAATGCAGGATGG + Intergenic
1023479061 7:40613419-40613441 TGGGGAAAACAAAGTCATGATGG - Intronic
1023987060 7:45102917-45102939 TGTGCCAGACAAACCCCTGATGG + Intronic
1027251736 7:76402965-76402987 TCGCCTAAAGAAACCAATGAAGG - Intronic
1028386161 7:90255699-90255721 TGAGATAGACAAACCCATGGTGG + Intronic
1030941699 7:115658779-115658801 TAGGATAAACAAAACCATGTTGG - Intergenic
1036454448 8:8894425-8894447 TTGGTTAAAGAAACCCATAAAGG + Intergenic
1037452051 8:19025327-19025349 TTGGTTAAAGAAACCCATAAAGG + Intronic
1038279731 8:26153065-26153087 TTGGTTAAAGAAACCCATAAAGG - Intergenic
1043360722 8:79468877-79468899 TTGGTTAAAGAAACCCATAAAGG - Intergenic
1044893421 8:96862053-96862075 TGGCATAAGCAAAGCCATGAAGG + Intronic
1050163611 9:2742523-2742545 TTGGTTAAAGAAACCCATAAGGG - Intronic
1050997103 9:12234246-12234268 TTGGTTAAAGAAACCCATAAAGG - Intergenic
1053251056 9:36574125-36574147 TGGGAGAAACAAGCCCACGAAGG - Intronic
1054739894 9:68794524-68794546 TGAACCAGACAAACCCATGAAGG - Intronic
1054847086 9:69809102-69809124 TGGGCCACCCAAACCCATAACGG - Intergenic
1055181573 9:73394035-73394057 TTGGCTAAAGAAACCCATAAAGG + Intergenic
1056967668 9:91178527-91178549 TGGGCTAAACACCCCCAGGATGG + Intergenic
1061757444 9:132824897-132824919 TTGGCCCAACAATCCCATGAGGG + Intronic
1061948546 9:133922279-133922301 TGGGCTTCACATACCCAGGAAGG + Intronic
1185591848 X:1282576-1282598 TTGGGGAAACAAACCCAGGATGG - Intronic
1190103081 X:47537814-47537836 TGAGCTAAACATTCACATGATGG - Intergenic
1197607672 X:128604464-128604486 TGGGGTAAACAAAATGATGAGGG - Intergenic
1198213660 X:134537410-134537432 TGGGCTATGCAAGCCCTTGAGGG - Intergenic
1201735301 Y:17253824-17253846 TGGGATAAGCAAGCCCATGGTGG - Intergenic