ID: 1071835713

View in Genome Browser
Species Human (GRCh38)
Location 10:89415147-89415169
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835713_1071835728 25 Left 1071835713 10:89415147-89415169 CCGGGCGACGCTCCCCCGGAAGG No data
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data
1071835713_1071835720 3 Left 1071835713 10:89415147-89415169 CCGGGCGACGCTCCCCCGGAAGG No data
Right 1071835720 10:89415173-89415195 GTCCACCCATCGCGACCCGACGG No data
1071835713_1071835727 19 Left 1071835713 10:89415147-89415169 CCGGGCGACGCTCCCCCGGAAGG No data
Right 1071835727 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG No data
1071835713_1071835724 13 Left 1071835713 10:89415147-89415169 CCGGGCGACGCTCCCCCGGAAGG No data
Right 1071835724 10:89415183-89415205 CGCGACCCGACGGCTCTTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835713 Original CRISPR CCTTCCGGGGGAGCGTCGCC CGG (reversed) Intronic