ID: 1071835713

View in Genome Browser
Species Human (GRCh38)
Location 10:89415147-89415169
Sequence CCTTCCGGGGGAGCGTCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835713_1071835728 25 Left 1071835713 10:89415147-89415169 CCGGGCGACGCTCCCCCGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data
1071835713_1071835727 19 Left 1071835713 10:89415147-89415169 CCGGGCGACGCTCCCCCGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1071835727 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG No data
1071835713_1071835720 3 Left 1071835713 10:89415147-89415169 CCGGGCGACGCTCCCCCGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1071835720 10:89415173-89415195 GTCCACCCATCGCGACCCGACGG No data
1071835713_1071835724 13 Left 1071835713 10:89415147-89415169 CCGGGCGACGCTCCCCCGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1071835724 10:89415183-89415205 CGCGACCCGACGGCTCTTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835713 Original CRISPR CCTTCCGGGGGAGCGTCGCC CGG (reversed) Intronic
900476101 1:2877075-2877097 CCAGCCGGTGGAGCGGCGCCCGG - Intergenic
901559584 1:10059479-10059501 CCTTCCGGGAGAGCCTCCCAAGG - Intronic
917974328 1:180229664-180229686 CCGTCCGGCGGAGCGAAGCCGGG + Intergenic
923084992 1:230696509-230696531 CCTTCAGGGGGAGCACGGCCCGG - Intergenic
1066979589 10:42399911-42399933 TCTTCCTGGGGAGCTTCCCCTGG - Intergenic
1071461395 10:85900161-85900183 CCTTCCTGGGGAGCTCCACCAGG + Intronic
1071835713 10:89415147-89415169 CCTTCCGGGGGAGCGTCGCCCGG - Intronic
1076403527 10:130197891-130197913 ACTTGTGGGGGAGCATCGCCTGG + Intergenic
1076797644 10:132805905-132805927 CTGGCCGGGGGAGCGTCTCCTGG + Intergenic
1081867164 11:46366354-46366376 CCCAGCGGGGGAGCGACGCCGGG - Exonic
1084150409 11:67285568-67285590 CCTCCCGGGGGAGCTGGGCCAGG - Exonic
1085047714 11:73363104-73363126 CCTTCCGGAGGGGCATGGCCAGG + Intronic
1087260050 11:96001261-96001283 CCTTCAGTGGGAGAGTGGCCAGG + Intronic
1090447412 11:126776044-126776066 CCCTCTGGGGGAGCTTCCCCAGG - Intronic
1091108416 11:132943743-132943765 CCAGCCGGGGGAGCGCCGCCCGG + Intronic
1095919930 12:47518740-47518762 CCTTCCCAGGGAGCCTCACCTGG + Intergenic
1105013662 12:132773065-132773087 CCTTCTGGGGCAGCGGCGCACGG + Exonic
1111979734 13:95003233-95003255 GCTTCCGGGGGGACTTCGCCGGG - Intergenic
1117176448 14:53152022-53152044 CCTTCGGGGGTAGCGCCTCCTGG - Intronic
1124240132 15:28021613-28021635 TCTTCCTGGGGAGCGTCCGCTGG - Intronic
1136666716 16:31819350-31819372 CCCTCCGGGGAAGCGCAGCCCGG + Intergenic
1153335386 18:3918692-3918714 CCTTCCTGGGGATCGTGGGCAGG + Intronic
1157337910 18:46755060-46755082 CCTTCCCAGGGAGCGTTCCCTGG - Intronic
1158931734 18:62329768-62329790 CCTGCCTGGGGAGCGCTGCCAGG - Intronic
1159045649 18:63366902-63366924 CCTTCCTGGGGACCGCGGCCTGG + Intronic
1160670546 19:360674-360696 CCCTCAGGAGGAGCGTCGGCTGG + Intergenic
1160670696 19:361442-361464 CCCTCAGGAGGAGCGTCGGCTGG + Intergenic
925302562 2:2827522-2827544 CATTCCAGGGGAGCCTCTCCAGG - Intergenic
926092538 2:10060097-10060119 CCTTCCGAGGCAGCATCTCCAGG - Intronic
933751224 2:85602945-85602967 CCTGCCGGGGAAGCGTCAGCAGG + Intronic
944512461 2:200477919-200477941 CCTTCCGGGGTAGTGTCGGTAGG + Exonic
1176263715 20:64197629-64197651 CCTTCCCGGGGAGCCACACCAGG - Intronic
1184639856 22:45864777-45864799 CCTTCCTGGGGAGCAGGGCCGGG - Intergenic
961109150 3:124268913-124268935 CCTTCCGGGCTAGCATCTCCTGG - Exonic
981573226 4:146175918-146175940 CTTTCCGGGGCTGCCTCGCCCGG - Exonic
984964532 4:185128581-185128603 GATTCCGAGGGAGCGTCGCGGGG - Intergenic
998098719 5:139413949-139413971 CCTTCCTGGGGAGTGGCTCCAGG - Exonic
1001406324 5:171479982-171480004 CCTTCCTGGGGAGGGTCCCCTGG + Intergenic
1002416339 5:179122773-179122795 ACTGCAGGGGGAGAGTCGCCAGG + Exonic
1005267311 6:24125977-24125999 CCATCCTGGGGAGCCTCGGCAGG + Intergenic
1005638413 6:27772622-27772644 GCTTCCTGGGGCGCGCCGCCTGG - Intergenic
1029540670 7:101180304-101180326 GCTGCCGCCGGAGCGTCGCCGGG - Intergenic
1029945037 7:104523840-104523862 CCTTCCTGAGGAGCATTGCCAGG - Intronic
1034400099 7:150856536-150856558 CCTTCCTGGGCAGAGTCCCCGGG - Exonic
1035664848 8:1373328-1373350 CCTTCCGGAGGCGCCGCGCCTGG + Intergenic
1049403925 8:142443257-142443279 CCTTCCGGGGGAGCAGAGACTGG + Intergenic
1057055623 9:91958390-91958412 CCTTCAGAGGGAGCATGGCCTGG + Intergenic
1061135515 9:128731234-128731256 CCTTCCGAGGGAGCCTCCCACGG - Exonic
1061927051 9:133811069-133811091 CCTTCCCGGGGAGCCTGGCTGGG - Intronic
1185449949 X:276555-276577 GGTTCAGGGGGAGGGTCGCCTGG + Intronic
1189021835 X:37349441-37349463 CCTTCCTGGGGCGCTTCGCCTGG - Exonic
1192166222 X:68829231-68829253 CTGTCCGGGGGCGCGTAGCCCGG + Exonic