ID: 1071835715

View in Genome Browser
Species Human (GRCh38)
Location 10:89415159-89415181
Sequence TGGGTGGACAGGCCTTCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835715_1071835728 13 Left 1071835715 10:89415159-89415181 CCCCCGGAAGGCCTGTCCACCCA No data
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data
1071835715_1071835724 1 Left 1071835715 10:89415159-89415181 CCCCCGGAAGGCCTGTCCACCCA No data
Right 1071835724 10:89415183-89415205 CGCGACCCGACGGCTCTTCTCGG No data
1071835715_1071835727 7 Left 1071835715 10:89415159-89415181 CCCCCGGAAGGCCTGTCCACCCA No data
Right 1071835727 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG No data
1071835715_1071835729 25 Left 1071835715 10:89415159-89415181 CCCCCGGAAGGCCTGTCCACCCA No data
Right 1071835729 10:89415207-89415229 AGCGGCGACGGTGACCGTGCTGG No data
1071835715_1071835730 26 Left 1071835715 10:89415159-89415181 CCCCCGGAAGGCCTGTCCACCCA No data
Right 1071835730 10:89415208-89415230 GCGGCGACGGTGACCGTGCTGGG No data
1071835715_1071835720 -9 Left 1071835715 10:89415159-89415181 CCCCCGGAAGGCCTGTCCACCCA No data
Right 1071835720 10:89415173-89415195 GTCCACCCATCGCGACCCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835715 Original CRISPR TGGGTGGACAGGCCTTCCGG GGG (reversed) Intronic
No off target data available for this crispr