ID: 1071835717

View in Genome Browser
Species Human (GRCh38)
Location 10:89415161-89415183
Sequence GATGGGTGGACAGGCCTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835717_1071835724 -1 Left 1071835717 10:89415161-89415183 CCCGGAAGGCCTGTCCACCCATC 0: 1
1: 0
2: 2
3: 18
4: 212
Right 1071835724 10:89415183-89415205 CGCGACCCGACGGCTCTTCTCGG No data
1071835717_1071835730 24 Left 1071835717 10:89415161-89415183 CCCGGAAGGCCTGTCCACCCATC 0: 1
1: 0
2: 2
3: 18
4: 212
Right 1071835730 10:89415208-89415230 GCGGCGACGGTGACCGTGCTGGG No data
1071835717_1071835727 5 Left 1071835717 10:89415161-89415183 CCCGGAAGGCCTGTCCACCCATC 0: 1
1: 0
2: 2
3: 18
4: 212
Right 1071835727 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG No data
1071835717_1071835729 23 Left 1071835717 10:89415161-89415183 CCCGGAAGGCCTGTCCACCCATC 0: 1
1: 0
2: 2
3: 18
4: 212
Right 1071835729 10:89415207-89415229 AGCGGCGACGGTGACCGTGCTGG No data
1071835717_1071835728 11 Left 1071835717 10:89415161-89415183 CCCGGAAGGCCTGTCCACCCATC 0: 1
1: 0
2: 2
3: 18
4: 212
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835717 Original CRISPR GATGGGTGGACAGGCCTTCC GGG (reversed) Intronic
900129637 1:1081935-1081957 GAGGGGTGGCCTGGCCTTCGGGG - Exonic
900545938 1:3229247-3229269 GCTGGGTGGACAGGTGTCCCTGG + Intronic
900730696 1:4257351-4257373 GATGGATAGACAGGGGTTCCAGG + Intergenic
901403668 1:9031877-9031899 GAGGGGTGGGAAGGCCTTGCCGG + Intergenic
901635016 1:10666480-10666502 GTGGGCTGGCCAGGCCTTCCGGG - Intronic
901712722 1:11128315-11128337 GCTGGCTGGACAGACCCTCCTGG + Intronic
902977724 1:20101011-20101033 GGTAGGGGGACAGGCGTTCCAGG - Intergenic
903850207 1:26301305-26301327 AATGTGTGGACAGGCCTCCCGGG + Intronic
903939501 1:26919605-26919627 GGTGTGTGGAAAGGGCTTCCAGG - Intronic
904300014 1:29548182-29548204 GAGGGGTGGACAGGGCTGACTGG + Intergenic
904438660 1:30515608-30515630 GAAGGGTGGACAGGACTTGGGGG + Intergenic
904906370 1:33900072-33900094 GAGGGGAGGAAAGCCCTTCCAGG + Intronic
905059816 1:35130337-35130359 GATGTGGGGAGGGGCCTTCCAGG + Intergenic
905826103 1:41027331-41027353 GATGGGAGGGCAGGTTTTCCAGG - Exonic
906902395 1:49849289-49849311 GATGTGTGGGAAGGCCCTCCAGG + Intronic
907450092 1:54540886-54540908 GATGGCTGGAGTGGCCATCCAGG + Intergenic
910447756 1:87316149-87316171 GAAGGGTGGATAGGACTTCTAGG - Intergenic
910524104 1:88157611-88157633 GATTGGTGGACAAGACCTCCAGG + Intergenic
913211675 1:116587895-116587917 GAGGGGTGGAGAGGCCCTTCAGG + Intronic
913522258 1:119656026-119656048 GATGGATGGATGGGGCTTCCTGG - Intergenic
915335240 1:155137057-155137079 CAAGGCTGGAGAGGCCTTCCTGG - Intronic
915434482 1:155893525-155893547 GATTGATGTACATGCCTTCCTGG + Intergenic
916053052 1:161049362-161049384 CAAGGGTGGACAGGGCCTCCTGG - Intronic
921266218 1:213422966-213422988 TGTGGGTGGAAAGGCCTTCAGGG - Intergenic
922173673 1:223178377-223178399 GATGGATGGAGATTCCTTCCTGG - Intergenic
922203825 1:223429527-223429549 GGTGGGTGGACAGACCATTCTGG + Intergenic
922567186 1:226608358-226608380 CATGGGTGCCCAGGCCTTCTGGG - Exonic
1063034882 10:2276625-2276647 GCAGGGTGGTCAGGGCTTCCTGG - Intergenic
1063463316 10:6228050-6228072 GTTGGGAGGACAGTCCTTCAGGG + Intronic
1063529625 10:6819048-6819070 GATGGGAGGTGACGCCTTCCTGG - Intergenic
1063691591 10:8292807-8292829 TCTGGCTGGACAGGCCTTTCTGG - Intergenic
1064695579 10:17962081-17962103 GGTGGGTGGACAGGCAGTCCAGG + Intronic
1064993773 10:21278849-21278871 GTGTGGTGGACAGGCCTTGCGGG - Intergenic
1065130145 10:22612412-22612434 GGCAGGTGGACAGGGCTTCCAGG + Intronic
1065519608 10:26558885-26558907 GGTTGCTGAACAGGCCTTCCAGG - Intronic
1067909710 10:50333556-50333578 GATGGGTGGAAAGGCCTTACAGG - Intronic
1068946886 10:62738622-62738644 GATGGGTGGAGAAGGCATCCAGG + Intergenic
1070024544 10:72619805-72619827 GAACGGTGGAGAGGCATTCCAGG + Intronic
1070803477 10:79256747-79256769 AGTGGGTGGGCAGGCTTTCCTGG - Intronic
1071835717 10:89415161-89415183 GATGGGTGGACAGGCCTTCCGGG - Intronic
1072720885 10:97780458-97780480 GATGGGTGGAGAGGCGCCCCAGG + Intergenic
1072944892 10:99800830-99800852 GATGGGTAGCCAAGCCTTCAGGG - Intronic
1074079755 10:110158161-110158183 GGTGGGTGGAAAGGCATTCTGGG + Intergenic
1075674956 10:124289889-124289911 GTTGGGTTGAGAGGCCCTCCAGG - Intergenic
1076612977 10:131737907-131737929 GATGGGTTGAGATGTCTTCCAGG - Intergenic
1077411498 11:2405935-2405957 GATGGGTCCACAGCCCTGCCCGG - Intronic
1077832138 11:5884852-5884874 AATGGGTGCACAGGCCAACCCGG - Exonic
1077958587 11:7048669-7048691 GATGAGTGGAAAGGACTTCCAGG - Intronic
1078619520 11:12894012-12894034 GGTAGGTGGACAGACATTCCAGG + Intronic
1079394753 11:20051914-20051936 AATGGAAGGACAGTCCTTCCTGG - Intronic
1080269455 11:30435634-30435656 GATGGGTGGTCAGGCTTTGTTGG - Intronic
1082653110 11:55818868-55818890 GATGTGTAGATTGGCCTTCCTGG + Intergenic
1083675817 11:64324120-64324142 GAAGGGTTGAGAGGGCTTCCAGG + Intergenic
1084353208 11:68618487-68618509 GATGGGAGAACAGGCCGTGCCGG + Intergenic
1084788590 11:71458768-71458790 GATGTGTGCACAGGACTTTCTGG - Intronic
1084860024 11:72012180-72012202 GAAGGGTGGAGAGGCCGACCTGG + Intronic
1086423173 11:86657904-86657926 GATGGATGGACAGGGATTCAGGG + Intronic
1088795022 11:113260509-113260531 GATGCTTGGCCAAGCCTTCCTGG - Intronic
1092057648 12:5521183-5521205 GGTTGGGGGACAGGGCTTCCAGG + Intronic
1096504175 12:52082288-52082310 GCTGGGGGCACAGCCCTTCCCGG - Intergenic
1101735251 12:107458562-107458584 GAGGGGTGGATCTGCCTTCCAGG - Intronic
1102021814 12:109688405-109688427 AAAGGGTGGGCAGGCCCTCCTGG + Intergenic
1102868018 12:116389652-116389674 GCTGGGTGGACAGGGGGTCCAGG - Intergenic
1103208330 12:119148056-119148078 GATGGGTGGAAAAGCTTTGCTGG + Intronic
1104319629 12:127738521-127738543 GATGATTGGTCAGGCCTTCAGGG + Intergenic
1104856078 12:131903119-131903141 GAAGGGTGGACAGGCCCAGCTGG + Intronic
1107436325 13:40383436-40383458 GCTGGTTGGTCTGGCCTTCCTGG - Intergenic
1107799478 13:44090872-44090894 GAAATGTGGACAGGACTTCCAGG + Intergenic
1114092527 14:19302417-19302439 GATCGGTGGCCAGGGCTTGCGGG + Intergenic
1115641010 14:35335623-35335645 GAGGGGTGGGGAGGCCTTCCTGG + Intergenic
1119349306 14:73950717-73950739 CATGGGAAAACAGGCCTTCCCGG + Intronic
1119771490 14:77222771-77222793 GAGGGGTGGTCAGGGCTCCCTGG - Intronic
1120760591 14:88281179-88281201 GAATGGGGGACAGGCCTTCCAGG - Intronic
1121028949 14:90641348-90641370 GATGGGTAGTCAGGCCTTGATGG - Intronic
1121882685 14:97514822-97514844 GATGGAGGGGCAGGCCTGCCAGG + Intergenic
1122235881 14:100330435-100330457 GACGGGTGGGCAGGCCTCACAGG - Intergenic
1122800739 14:104228382-104228404 GATGGGTAGACAGGGCCCCCTGG + Intergenic
1122904266 14:104794904-104794926 GATGGGCGGGCAGGACCTCCAGG + Intronic
1123758280 15:23413938-23413960 TATGTGTGGAAAGGCCCTCCAGG + Intergenic
1127650529 15:61002174-61002196 GATGGGAGGGCCAGCCTTCCTGG - Intronic
1128096475 15:64960255-64960277 GCTGGATGGAAAGGCCTTCCTGG - Intergenic
1128525449 15:68409133-68409155 GAAGGGAAGAAAGGCCTTCCAGG - Intronic
1131408244 15:92184196-92184218 GGTGGGTGCTCAGGCCTTTCAGG - Intergenic
1131976676 15:97953433-97953455 GATGGGTGGAAGGGCCTGCACGG + Intergenic
1134458058 16:14408956-14408978 TATGTGTGGAAAGGCCCTCCAGG - Intergenic
1135356184 16:21771009-21771031 GCTCTGTGGACAGGCCTTTCTGG + Intergenic
1135454675 16:22587148-22587170 GCTCTGTGGACAGGCCTTTCTGG + Intergenic
1135549422 16:23386764-23386786 GAAGGCTGGCCAGGGCTTCCAGG + Intergenic
1136636194 16:31524760-31524782 GGTGGAAGGAGAGGCCTTCCTGG + Intergenic
1137256324 16:46778221-46778243 GATGGGCGGAGGGTCCTTCCTGG - Intronic
1138553966 16:57761630-57761652 GATGGCTGGAGAAGGCTTCCTGG - Intronic
1141066888 16:80921151-80921173 CAAGGATGGACAGGTCTTCCCGG + Intergenic
1141478688 16:84291992-84292014 GCTGGGTGGAAAAGCATTCCAGG + Intergenic
1141949657 16:87332377-87332399 GGAGGCTGGACAGGTCTTCCTGG + Intronic
1142190075 16:88713414-88713436 GCTGGGTCGAGGGGCCTTCCTGG + Exonic
1143372556 17:6449442-6449464 GATGGCTGGAGGGGCCCTCCCGG - Intronic
1148192462 17:45689087-45689109 GATGTGTGGCCAGGCCTGGCAGG + Intergenic
1151067847 17:71172441-71172463 GAAAAGTGGACGGGCCTTCCTGG - Intergenic
1151277851 17:73049391-73049413 GCTGGGCGGACGCGCCTTCCAGG + Intronic
1152424256 17:80210425-80210447 GATGTGTGCACAGGCCTCCTGGG + Exonic
1153625650 18:7020217-7020239 GAGGTGTGGACAGGCCGTCCAGG - Intronic
1153928444 18:9856352-9856374 AAGGTGTGGACAGACCTTCCTGG + Intronic
1153978239 18:10287960-10287982 GATGGGAGGACCTGACTTCCTGG + Intergenic
1154411297 18:14143558-14143580 GGTAGGTGGGCAGGCCTGCCTGG - Intergenic
1155583807 18:27342148-27342170 GATGGACAGACAGGCCTTGCTGG + Intergenic
1157589678 18:48828884-48828906 GATGGGAGGGCAAGCCGTCCAGG - Intronic
1157756980 18:50227443-50227465 GATGGGTGGACAGGACCTCCTGG + Exonic
1158474643 18:57769201-57769223 GAATGGCGGCCAGGCCTTCCTGG - Intronic
1159868787 18:73737053-73737075 GAAGAGTGGGCAGGACTTCCTGG - Intergenic
1160812141 19:1017492-1017514 GCTGGGTGGGCAGGGCCTCCTGG - Intronic
1161332841 19:3696584-3696606 GATGGGAGGAGGGGCATTCCGGG + Intronic
1161675722 19:5647436-5647458 CCTGAGTGGACAGGGCTTCCTGG + Intronic
1161682474 19:5687078-5687100 GACGGGTGGAGAGCCCTCCCTGG - Intronic
1162463932 19:10829811-10829833 GATGTCTGGACAGGGCTTGCAGG + Intronic
1162953460 19:14085488-14085510 GATGGGTTCCCAGGCCTGCCAGG + Exonic
1163451044 19:17377544-17377566 GCTGGCTGGTCAGGCATTCCTGG + Intergenic
1163482062 19:17562722-17562744 GATTGATGGACAGGCCTGCATGG + Intronic
1164882092 19:31741194-31741216 GGTGGGTGGAGGGGCCTCCCTGG + Intergenic
1165743596 19:38217608-38217630 GAGGGGCTGACAGGCCCTCCTGG - Intronic
1166088408 19:40492185-40492207 GTGGAGTGGACAGGCCTTACGGG + Intronic
1166213147 19:41320088-41320110 GGTGGGAGGAGAGGCATTCCTGG - Intronic
1166344920 19:42159527-42159549 GGAGGGTGGACAGGGCTTCTGGG - Intronic
1168011770 19:53538683-53538705 GATGGGTGATCGGGCCTTCTGGG + Intronic
1168013770 19:53555084-53555106 GATGGTTGGTCGGGCCTTCTGGG + Intronic
1168013780 19:53555160-53555182 GATGGGTGATCGGGCCTTCTGGG + Intronic
1168013792 19:53555236-53555258 GATGGGTGATCGGGCCTTCTGGG + Intronic
1168013802 19:53555312-53555334 GATGGGTGATCGGGCCTTCTGGG + Intronic
925162383 2:1694962-1694984 GATGCGTGGCTCGGCCTTCCGGG - Intronic
926245523 2:11120206-11120228 GTTGGGTGGGCAGGGCTTCCTGG - Intergenic
926369788 2:12168220-12168242 GATGACTGAACAGGCATTCCAGG + Intergenic
932836657 2:75044300-75044322 GTTGGGAGGAGAGGGCTTCCAGG + Intergenic
934650139 2:96085895-96085917 GATGGAGGGACGGGCCGTCCAGG + Intergenic
936261406 2:110962519-110962541 GAAAGGTGGCCGGGCCTTCCAGG + Intronic
938065797 2:128281309-128281331 GATGGGTGGAAAGGCAGTCCAGG + Intronic
938447981 2:131391903-131391925 GATGGGTGTCCAGCCCTGCCTGG + Intergenic
946041656 2:216787991-216788013 GCTAAGGGGACAGGCCTTCCTGG - Intergenic
948921182 2:241066641-241066663 GGTGGGTGGCCAGGGCTTCAGGG + Intronic
949049957 2:241892349-241892371 GATGGCTGGGCCGGCTTTCCAGG - Intergenic
1171329891 20:24328306-24328328 GTTGGGTGGCCATACCTTCCAGG - Intergenic
1172230723 20:33333907-33333929 GGTGCCTGGACAGGCCATCCTGG - Intergenic
1172562678 20:35903539-35903561 GATGGGGGTACATTCCTTCCTGG - Intronic
1174458759 20:50668140-50668162 GATGAGTGGACAGTTCTCCCGGG - Intronic
1175126024 20:56752092-56752114 GGTGGGAAGAAAGGCCTTCCTGG + Intergenic
1176020262 20:62959059-62959081 GAGGGGAGGACAGGCCTGGCGGG + Intronic
1176861759 21:14014859-14014881 GGTAGGTGGGCAGGCCTGCCTGG + Intergenic
1178944159 21:36932421-36932443 GGTGGGAGGAAAGGCCTTTCTGG - Intronic
1179460512 21:41531594-41531616 GATGGGTGGAGTGTGCTTCCAGG + Intergenic
1179664871 21:42904104-42904126 GAAGGGTGGACAGGCAATCGTGG + Exonic
1180488202 22:15820149-15820171 GATCGGTGGCCAGGGCTTGCGGG - Intergenic
1181460844 22:23085095-23085117 GATAGGTGGACATGGTTTCCAGG + Intronic
1181632424 22:24158169-24158191 GATGGGTGGGCAAGGCTTCCTGG - Intronic
1182305526 22:29365288-29365310 GATGTGTGGACAGACATGCCTGG - Intronic
1182312802 22:29421227-29421249 GATGTGTGGACAGACATGCCTGG - Intronic
1182814244 22:33145337-33145359 GATGGTTGTACAGAGCTTCCTGG - Intergenic
1184749366 22:46475957-46475979 GATGTGTGAACACACCTTCCTGG - Intronic
1184785615 22:46670267-46670289 GGTGGGAGGACAGGCCTCTCTGG + Intronic
1185336452 22:50272742-50272764 GAGGGGTGGCCTGTCCTTCCTGG - Intergenic
949096875 3:96754-96776 GAGAGGTAGACAGGCCTTACAGG + Intergenic
950651716 3:14411350-14411372 GATGGGAGGAAGGGCCTTGCGGG - Intronic
953884292 3:46706735-46706757 GAAGGCTGGAAAGGCATTCCGGG + Intronic
953923578 3:46968718-46968740 GATGGGTGGAGGCTCCTTCCCGG + Intronic
954382114 3:50225021-50225043 GAGGGAGGGACAGGCCTGCCTGG + Intergenic
954436845 3:50500775-50500797 GAAGGGAGGACAGGGCTTCAGGG - Intronic
954481601 3:50805472-50805494 GGTCGGTGGACATACCTTCCAGG + Intronic
954899688 3:54008257-54008279 GATGAGTGGGCAGGCATTCCAGG - Intergenic
960765316 3:121122314-121122336 GGTGGGTGGACTTGCCTTTCAGG - Intronic
963007609 3:140740694-140740716 GAGGAGGGGAAAGGCCTTCCAGG + Intergenic
966556673 3:181269588-181269610 GAAGGATGGGGAGGCCTTCCAGG - Intergenic
967079966 3:186040644-186040666 GATGGGTGGACAGGTATTGGCGG - Intergenic
967272740 3:187744332-187744354 GATGGCGGGACAGGGCTTCTTGG - Intronic
968484215 4:850910-850932 GGTGGGTGGGCAGCTCTTCCTGG - Intronic
968732010 4:2273695-2273717 GAGGGGTGGACATGCTTTGCAGG - Intronic
968898719 4:3420521-3420543 GATGGGTGGGGGGGGCTTCCTGG + Intronic
969278739 4:6154852-6154874 GATGGATGAATAGGCCTTCGAGG - Intronic
969726279 4:8920283-8920305 GATGTGGGGACAGGCCATCTGGG + Intergenic
971583007 4:28367251-28367273 GAGGGGTGGAGAAGCCTTCAGGG + Intronic
975329499 4:73098768-73098790 GATGGCTGGAATGGCCTTCCTGG - Intronic
976840259 4:89424414-89424436 GATGGATGGATAGATCTTCCAGG - Intergenic
981400713 4:144310739-144310761 GAAGAGTTGACAGGACTTCCTGG - Intergenic
983111213 4:163751917-163751939 GATGGGAGGACTTGCCTTACTGG + Intronic
985558828 5:571175-571197 GCTGTGTGGACAGCCCTTGCCGG - Intergenic
985861145 5:2471588-2471610 AAGGGGTGGCCAGGCCTTCTGGG - Intergenic
985980752 5:3461124-3461146 GATGGTAGAACAGGCCTTCCAGG + Intergenic
987706697 5:21468384-21468406 TCTGGCTGGACAGGCCTTTCTGG + Intergenic
995454657 5:112338499-112338521 GATGGTTTGAAGGGCCTTCCTGG - Intronic
998456455 5:142277545-142277567 GATCTGGGGACAGACCTTCCTGG + Intergenic
999091066 5:148936183-148936205 CGTTGGTGGACATGCCTTCCAGG + Intronic
1000254836 5:159527655-159527677 GGTGGGTGGAAAAGCTTTCCTGG + Intergenic
1002427029 5:179182522-179182544 GATGGGTGGACAGGCATACAGGG + Intronic
1002931358 6:1637256-1637278 GATGCCTGGAAAGGCCTTACTGG - Intronic
1006198841 6:32267818-32267840 AGTGAGTGGACAGGCCTTGCTGG - Intergenic
1006392953 6:33769578-33769600 GATGGGTGGAGAGGCTGGCCTGG + Intergenic
1007159242 6:39775434-39775456 GAAGGGTGGAAAGGGCATCCAGG + Intergenic
1007662823 6:43496874-43496896 GATGGGTGCACACCCCTCCCTGG - Intronic
1010187104 6:73157207-73157229 GGTGGGAGGTCAGGCCTTGCAGG + Intronic
1017878692 6:158544737-158544759 GAGGCGTGGGCAGGCCTTACAGG - Intronic
1018913022 6:168115103-168115125 GATGGGTGGATGGGCCCTGCAGG - Intergenic
1019014205 6:168867838-168867860 GCTGGGTTGACCGTCCTTCCGGG + Intergenic
1019216247 6:170445638-170445660 GAAGTGTGGAAATGCCTTCCGGG + Intergenic
1019510259 7:1414177-1414199 GCTGGGTGGGGAGGCCTTGCCGG + Intergenic
1020098776 7:5382769-5382791 GATGGGGAGACAGGCCTGCAGGG - Intronic
1029318730 7:99738280-99738302 CATGAGTGGACAGGCTGTCCAGG + Intergenic
1032165779 7:129543697-129543719 GGTGGGTGGGCAGGTATTCCAGG - Intergenic
1032283266 7:130523277-130523299 GATGATTGGATAGGCCTGCCTGG - Intronic
1032284010 7:130527503-130527525 GATGATTGGATAGGCCTGCCTGG - Intronic
1032284782 7:130531883-130531905 GATGATTGGATAGGCCTGCCTGG - Intronic
1032285577 7:130536415-130536437 GATGATTGGATAGGCCTGCCTGG - Intronic
1032384745 7:131513919-131513941 GATTGGTTGTCAGGCCTTACTGG + Intronic
1033999389 7:147392888-147392910 GATGTCTGGACATGCCATCCAGG - Intronic
1037508510 8:19557228-19557250 TATGGGTAGACAGGGATTCCGGG - Intronic
1037755862 8:21709762-21709784 GATGGGAGAACTGGCCTTGCGGG - Intronic
1038703993 8:29877064-29877086 GATGGGTAGACAGCCCTGACAGG + Intergenic
1040111596 8:43569233-43569255 TACAGGTGGCCAGGCCTTCCGGG - Intergenic
1042499540 8:69492949-69492971 GATCAGAGGCCAGGCCTTCCCGG + Intronic
1048822240 8:138391146-138391168 AATGGGAGGACAGGGATTCCAGG - Intronic
1049538111 8:143191906-143191928 GATGATGGGACAGGCCTTCTCGG + Intergenic
1057050164 9:91917569-91917591 GTTGGGTGCCCAGGTCTTCCTGG - Intronic
1058702099 9:107609685-107609707 GATGGGAGTTCAGGGCTTCCAGG - Intergenic
1060274188 9:122169907-122169929 GATATGAGGACTGGCCTTCCTGG - Intronic
1061216486 9:129224771-129224793 GAGGGGGGCACAGGCCTACCTGG - Intergenic
1061792914 9:133067919-133067941 AATGGGTCCCCAGGCCTTCCCGG - Intronic
1062524543 9:136972921-136972943 GATGGGTGGGCAGGGCCTCGGGG + Intergenic
1203776538 EBV:76166-76188 TATGTGTGGACAGGCCTCCATGG + Intergenic
1203781793 EBV:105020-105042 GATGGGTGGAGAGGCCACCGTGG - Intergenic
1187411193 X:19051798-19051820 GATGTGTGCACAGGCCATCCTGG + Intronic
1189261316 X:39680701-39680723 GGTGGGTGGCCAGGCCTTACTGG + Intergenic
1190416164 X:50182600-50182622 GGTGGGTGGACAGGCCTAGCTGG - Intergenic
1191254870 X:58275331-58275353 GATAGGTGGCCAGGCCTTCATGG - Intergenic
1191867414 X:65716201-65716223 TATAGATGGAAAGGCCTTCCTGG + Intronic
1193333226 X:80258717-80258739 GATGAGAGGACAGGCCTTTGGGG + Intergenic
1195791927 X:108597530-108597552 GATGGATTGCCAGGGCTTCCTGG + Exonic
1196520727 X:116667955-116667977 GACGGGTGGGAAGGGCTTCCTGG - Intergenic
1200060631 X:153482259-153482281 GGTCGGGGCACAGGCCTTCCTGG - Intronic