ID: 1071835718

View in Genome Browser
Species Human (GRCh38)
Location 10:89415162-89415184
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835718_1071835730 23 Left 1071835718 10:89415162-89415184 CCGGAAGGCCTGTCCACCCATCG No data
Right 1071835730 10:89415208-89415230 GCGGCGACGGTGACCGTGCTGGG No data
1071835718_1071835724 -2 Left 1071835718 10:89415162-89415184 CCGGAAGGCCTGTCCACCCATCG No data
Right 1071835724 10:89415183-89415205 CGCGACCCGACGGCTCTTCTCGG No data
1071835718_1071835729 22 Left 1071835718 10:89415162-89415184 CCGGAAGGCCTGTCCACCCATCG No data
Right 1071835729 10:89415207-89415229 AGCGGCGACGGTGACCGTGCTGG No data
1071835718_1071835731 30 Left 1071835718 10:89415162-89415184 CCGGAAGGCCTGTCCACCCATCG No data
Right 1071835731 10:89415215-89415237 CGGTGACCGTGCTGGGTCCGCGG 0: 1
1: 1
2: 1
3: 10
4: 86
1071835718_1071835727 4 Left 1071835718 10:89415162-89415184 CCGGAAGGCCTGTCCACCCATCG No data
Right 1071835727 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG No data
1071835718_1071835728 10 Left 1071835718 10:89415162-89415184 CCGGAAGGCCTGTCCACCCATCG No data
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835718 Original CRISPR CGATGGGTGGACAGGCCTTC CGG (reversed) Intronic