ID: 1071835719

View in Genome Browser
Species Human (GRCh38)
Location 10:89415170-89415192
Sequence TCGGGTCGCGATGGGTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835719_1071835730 15 Left 1071835719 10:89415170-89415192 CCTGTCCACCCATCGCGACCCGA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1071835730 10:89415208-89415230 GCGGCGACGGTGACCGTGCTGGG No data
1071835719_1071835724 -10 Left 1071835719 10:89415170-89415192 CCTGTCCACCCATCGCGACCCGA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1071835724 10:89415183-89415205 CGCGACCCGACGGCTCTTCTCGG No data
1071835719_1071835729 14 Left 1071835719 10:89415170-89415192 CCTGTCCACCCATCGCGACCCGA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1071835729 10:89415207-89415229 AGCGGCGACGGTGACCGTGCTGG No data
1071835719_1071835731 22 Left 1071835719 10:89415170-89415192 CCTGTCCACCCATCGCGACCCGA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1071835731 10:89415215-89415237 CGGTGACCGTGCTGGGTCCGCGG No data
1071835719_1071835727 -4 Left 1071835719 10:89415170-89415192 CCTGTCCACCCATCGCGACCCGA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1071835727 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG No data
1071835719_1071835728 2 Left 1071835719 10:89415170-89415192 CCTGTCCACCCATCGCGACCCGA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835719 Original CRISPR TCGGGTCGCGATGGGTGGAC AGG (reversed) Intronic
900145473 1:1157293-1157315 TGGGGGCGGGATGGGTGGGCTGG - Intergenic
907516926 1:54998787-54998809 TGGGGTTGAGCTGGGTGGACAGG - Intergenic
915977383 1:160400314-160400336 TCGGGTCCCGAACGGTGGGCAGG - Intergenic
920874971 1:209826368-209826390 TGGGGTGGGGATGGGAGGACAGG - Intergenic
1066058223 10:31700660-31700682 TCGAGCAGCGATGGGAGGACAGG + Intergenic
1071835719 10:89415170-89415192 TCGGGTCGCGATGGGTGGACAGG - Intronic
1072572471 10:96670850-96670872 TCGGGGTGGGATGGGTGGTCAGG - Intronic
1089384434 11:118058678-118058700 TCGGGTCCAGATGGGTGCCCTGG - Intergenic
1089689523 11:120178669-120178691 TAGGGTGGTGATGGGTGGAAAGG - Intronic
1122297753 14:100714709-100714731 TGGGCTCGCCATTGGTGGACAGG + Intergenic
1152002465 17:77655267-77655289 TCGGGTAGAGGTGGGTGGACAGG + Intergenic
1167141023 19:47650904-47650926 TGGTGTCAAGATGGGTGGACCGG - Intronic
1167766145 19:51483786-51483808 CAGGGACGGGATGGGTGGACGGG + Intronic
931428921 2:62195069-62195091 GCGGGTCTCGCTGGCTGGACTGG + Intergenic
947118497 2:226795843-226795865 TGGGGTCGAGATGGGCAGACTGG - Exonic
948610937 2:239166482-239166504 TAGGGTGGCGGTGGGGGGACAGG + Intronic
1176194242 20:63830390-63830412 TCGGGGCGCGCGGGGCGGACGGG - Intronic
1185000684 22:48243762-48243784 TGGGGTGGCCATGGGTGGAGGGG - Intergenic
1185329356 22:50245294-50245316 CCGGGGCGCGATGGGTGGGGCGG + Exonic
949840074 3:8310974-8310996 TTGGGTACCGATGGGTGGTCTGG - Intergenic
949896261 3:8769168-8769190 TCGGGTCCCGATGGCTCCACCGG + Intronic
968641344 4:1716594-1716616 TGGGGTGGCAATGGGAGGACAGG - Exonic
983068924 4:163246202-163246224 TCAGTTGGCGGTGGGTGGACAGG + Intergenic
986705748 5:10453322-10453344 TCGGGGTGCGCTGGGTAGACAGG + Intronic
988796253 5:34656175-34656197 TGGGGCCGCGAGGGGTGGAATGG + Intergenic
1007816669 6:44529785-44529807 TGGGGTCCAGATGGGTGGAACGG + Intergenic
1053232738 9:36424636-36424658 TGTGGTCGTGATGGATGGACTGG + Intronic
1060916917 9:127397363-127397385 GCGGGGCGCGCTGGGGGGACAGG - Exonic
1061450164 9:130663464-130663486 GGGGGTCGAGATGGGCGGACAGG - Intergenic