ID: 1071835720 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:89415173-89415195 |
Sequence | GTCCACCCATCGCGACCCGA CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1071835715_1071835720 | -9 | Left | 1071835715 | 10:89415159-89415181 | CCCCCGGAAGGCCTGTCCACCCA | No data | ||
Right | 1071835720 | 10:89415173-89415195 | GTCCACCCATCGCGACCCGACGG | No data | ||||
1071835716_1071835720 | -10 | Left | 1071835716 | 10:89415160-89415182 | CCCCGGAAGGCCTGTCCACCCAT | No data | ||
Right | 1071835720 | 10:89415173-89415195 | GTCCACCCATCGCGACCCGACGG | No data | ||||
1071835713_1071835720 | 3 | Left | 1071835713 | 10:89415147-89415169 | CCGGGCGACGCTCCCCCGGAAGG | No data | ||
Right | 1071835720 | 10:89415173-89415195 | GTCCACCCATCGCGACCCGACGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1071835720 | Original CRISPR | GTCCACCCATCGCGACCCGA CGG | Intronic | ||