ID: 1071835720

View in Genome Browser
Species Human (GRCh38)
Location 10:89415173-89415195
Sequence GTCCACCCATCGCGACCCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835715_1071835720 -9 Left 1071835715 10:89415159-89415181 CCCCCGGAAGGCCTGTCCACCCA No data
Right 1071835720 10:89415173-89415195 GTCCACCCATCGCGACCCGACGG No data
1071835716_1071835720 -10 Left 1071835716 10:89415160-89415182 CCCCGGAAGGCCTGTCCACCCAT 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1071835720 10:89415173-89415195 GTCCACCCATCGCGACCCGACGG No data
1071835713_1071835720 3 Left 1071835713 10:89415147-89415169 CCGGGCGACGCTCCCCCGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1071835720 10:89415173-89415195 GTCCACCCATCGCGACCCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835720 Original CRISPR GTCCACCCATCGCGACCCGA CGG Intronic
No off target data available for this crispr