ID: 1071835721

View in Genome Browser
Species Human (GRCh38)
Location 10:89415175-89415197
Sequence AGCCGTCGGGTCGCGATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835721_1071835728 -3 Left 1071835721 10:89415175-89415197 CCACCCATCGCGACCCGACGGCT No data
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data
1071835721_1071835733 30 Left 1071835721 10:89415175-89415197 CCACCCATCGCGACCCGACGGCT No data
Right 1071835733 10:89415228-89415250 GGGTCCGCGGCCGCCGCCTCCGG No data
1071835721_1071835727 -9 Left 1071835721 10:89415175-89415197 CCACCCATCGCGACCCGACGGCT No data
Right 1071835727 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG No data
1071835721_1071835729 9 Left 1071835721 10:89415175-89415197 CCACCCATCGCGACCCGACGGCT No data
Right 1071835729 10:89415207-89415229 AGCGGCGACGGTGACCGTGCTGG No data
1071835721_1071835731 17 Left 1071835721 10:89415175-89415197 CCACCCATCGCGACCCGACGGCT No data
Right 1071835731 10:89415215-89415237 CGGTGACCGTGCTGGGTCCGCGG 0: 1
1: 1
2: 1
3: 10
4: 86
1071835721_1071835730 10 Left 1071835721 10:89415175-89415197 CCACCCATCGCGACCCGACGGCT No data
Right 1071835730 10:89415208-89415230 GCGGCGACGGTGACCGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835721 Original CRISPR AGCCGTCGGGTCGCGATGGG TGG (reversed) Intronic