ID: 1071835721

View in Genome Browser
Species Human (GRCh38)
Location 10:89415175-89415197
Sequence AGCCGTCGGGTCGCGATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 17}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835721_1071835731 17 Left 1071835721 10:89415175-89415197 CCACCCATCGCGACCCGACGGCT 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1071835731 10:89415215-89415237 CGGTGACCGTGCTGGGTCCGCGG No data
1071835721_1071835730 10 Left 1071835721 10:89415175-89415197 CCACCCATCGCGACCCGACGGCT 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1071835730 10:89415208-89415230 GCGGCGACGGTGACCGTGCTGGG No data
1071835721_1071835729 9 Left 1071835721 10:89415175-89415197 CCACCCATCGCGACCCGACGGCT 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1071835729 10:89415207-89415229 AGCGGCGACGGTGACCGTGCTGG No data
1071835721_1071835727 -9 Left 1071835721 10:89415175-89415197 CCACCCATCGCGACCCGACGGCT 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1071835727 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG No data
1071835721_1071835728 -3 Left 1071835721 10:89415175-89415197 CCACCCATCGCGACCCGACGGCT 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data
1071835721_1071835733 30 Left 1071835721 10:89415175-89415197 CCACCCATCGCGACCCGACGGCT 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1071835733 10:89415228-89415250 GGGTCCGCGGCCGCCGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835721 Original CRISPR AGCCGTCGGGTCGCGATGGG TGG (reversed) Intronic
900610397 1:3542200-3542222 AGCCCTCGGGCCTGGATGGGTGG + Intronic
1071835721 10:89415175-89415197 AGCCGTCGGGTCGCGATGGGTGG - Intronic
1100985618 12:100199683-100199705 AGCCGTCGGTTCGTGTTGGACGG - Intronic
1118350729 14:64971489-64971511 AGCCGGCGGGGGGCGAGGGGGGG - Intronic
1123051919 14:105548113-105548135 TGCCGGCGGGTGGCGGTGGGGGG - Intergenic
1140078633 16:71723950-71723972 AGCCGGCGGGCCGCGGGGGGCGG - Intronic
1142029712 16:87832397-87832419 AGCCGTAGGGTGGCACTGGGAGG - Exonic
1151883012 17:76906066-76906088 AGCCCTCGGGTCCTGAAGGGCGG + Exonic
1156502170 18:37566851-37566873 AGCTGTCGGGCCGCGCCGGGGGG + Intergenic
1159060830 18:63512214-63512236 GGCTGTGGGGTCGCGGTGGGTGG + Intergenic
1160261917 18:77302005-77302027 AGCCCTGCGGTCGCGATGGCAGG - Intergenic
1161307835 19:3577472-3577494 AGCGGTGGGGGCGCGAAGGGTGG - Intronic
1185377316 22:50488450-50488472 AGCCGTCGGGGGGCCGTGGGGGG - Intronic
1185391294 22:50562803-50562825 AGCCGTCAGGGCGCGTTGGGAGG + Intronic
973142117 4:46781935-46781957 AGCCCTCCGGGCGGGATGGGGGG - Intronic
1014649450 6:124017774-124017796 AGCCGGGGGGTCGGGGTGGGGGG - Intronic
1015115456 6:129644082-129644104 AACCTTGGGGTGGCGATGGGTGG + Intronic
1061331019 9:129893256-129893278 AGGCCTGGGGTCGGGATGGGTGG + Intronic
1199634849 X:149805348-149805370 AGCGGTGGGGTGGCGAAGGGTGG - Intergenic