ID: 1071835721 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:89415175-89415197 |
| Sequence | AGCCGTCGGGTCGCGATGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 6 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1071835721_1071835731 | 17 | Left | 1071835721 | 10:89415175-89415197 | CCACCCATCGCGACCCGACGGCT | No data | ||
| Right | 1071835731 | 10:89415215-89415237 | CGGTGACCGTGCTGGGTCCGCGG | 0: 1 1: 1 2: 1 3: 10 4: 86 |
||||
| 1071835721_1071835729 | 9 | Left | 1071835721 | 10:89415175-89415197 | CCACCCATCGCGACCCGACGGCT | No data | ||
| Right | 1071835729 | 10:89415207-89415229 | AGCGGCGACGGTGACCGTGCTGG | No data | ||||
| 1071835721_1071835727 | -9 | Left | 1071835721 | 10:89415175-89415197 | CCACCCATCGCGACCCGACGGCT | No data | ||
| Right | 1071835727 | 10:89415189-89415211 | CCGACGGCTCTTCTCGGCAGCGG | No data | ||||
| 1071835721_1071835728 | -3 | Left | 1071835721 | 10:89415175-89415197 | CCACCCATCGCGACCCGACGGCT | No data | ||
| Right | 1071835728 | 10:89415195-89415217 | GCTCTTCTCGGCAGCGGCGACGG | No data | ||||
| 1071835721_1071835730 | 10 | Left | 1071835721 | 10:89415175-89415197 | CCACCCATCGCGACCCGACGGCT | No data | ||
| Right | 1071835730 | 10:89415208-89415230 | GCGGCGACGGTGACCGTGCTGGG | No data | ||||
| 1071835721_1071835733 | 30 | Left | 1071835721 | 10:89415175-89415197 | CCACCCATCGCGACCCGACGGCT | No data | ||
| Right | 1071835733 | 10:89415228-89415250 | GGGTCCGCGGCCGCCGCCTCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1071835721 | Original CRISPR | AGCCGTCGGGTCGCGATGGG TGG (reversed) | Intronic | ||