ID: 1071835722

View in Genome Browser
Species Human (GRCh38)
Location 10:89415178-89415200
Sequence AAGAGCCGTCGGGTCGCGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 8}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835722_1071835730 7 Left 1071835722 10:89415178-89415200 CCCATCGCGACCCGACGGCTCTT 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1071835730 10:89415208-89415230 GCGGCGACGGTGACCGTGCTGGG No data
1071835722_1071835728 -6 Left 1071835722 10:89415178-89415200 CCCATCGCGACCCGACGGCTCTT 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data
1071835722_1071835729 6 Left 1071835722 10:89415178-89415200 CCCATCGCGACCCGACGGCTCTT 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1071835729 10:89415207-89415229 AGCGGCGACGGTGACCGTGCTGG No data
1071835722_1071835731 14 Left 1071835722 10:89415178-89415200 CCCATCGCGACCCGACGGCTCTT 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1071835731 10:89415215-89415237 CGGTGACCGTGCTGGGTCCGCGG No data
1071835722_1071835734 28 Left 1071835722 10:89415178-89415200 CCCATCGCGACCCGACGGCTCTT 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1071835734 10:89415229-89415251 GGTCCGCGGCCGCCGCCTCCGGG No data
1071835722_1071835733 27 Left 1071835722 10:89415178-89415200 CCCATCGCGACCCGACGGCTCTT 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1071835733 10:89415228-89415250 GGGTCCGCGGCCGCCGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835722 Original CRISPR AAGAGCCGTCGGGTCGCGAT GGG (reversed) Intronic
901849380 1:12005896-12005918 AACAGCCGTCGGGCCTTGATGGG + Exonic
1071835722 10:89415178-89415200 AAGAGCCGTCGGGTCGCGATGGG - Intronic
1076116657 10:127906196-127906218 AAGAGTCGTCGGCTGGCAATCGG + Intergenic
1115993095 14:39169912-39169934 GGGAGGCGTCGGGTGGCGATGGG + Intronic
1123030721 14:105449882-105449904 AGGAGCCGCCGGGCCGCCATAGG + Intronic
1128721383 15:69952438-69952460 AAGAGCCATCGGGTCTCTACTGG + Intergenic
1163782537 19:19257950-19257972 AAGAGCCGTCGGGTGGCGTCCGG + Exonic
1166792527 19:45406415-45406437 GAGGCCCGTCGGGTCCCGATGGG - Exonic
1167120828 19:47515360-47515382 AGGAGCCCTCGGCTCGCGCTGGG + Intergenic
1061331018 9:129893253-129893275 AAGAGGCCTGGGGTCGGGATGGG + Intronic