ID: 1071835723

View in Genome Browser
Species Human (GRCh38)
Location 10:89415179-89415201
Sequence GAAGAGCCGTCGGGTCGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 17}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835723_1071835734 27 Left 1071835723 10:89415179-89415201 CCATCGCGACCCGACGGCTCTTC 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1071835734 10:89415229-89415251 GGTCCGCGGCCGCCGCCTCCGGG No data
1071835723_1071835731 13 Left 1071835723 10:89415179-89415201 CCATCGCGACCCGACGGCTCTTC 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1071835731 10:89415215-89415237 CGGTGACCGTGCTGGGTCCGCGG No data
1071835723_1071835733 26 Left 1071835723 10:89415179-89415201 CCATCGCGACCCGACGGCTCTTC 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1071835733 10:89415228-89415250 GGGTCCGCGGCCGCCGCCTCCGG No data
1071835723_1071835729 5 Left 1071835723 10:89415179-89415201 CCATCGCGACCCGACGGCTCTTC 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1071835729 10:89415207-89415229 AGCGGCGACGGTGACCGTGCTGG No data
1071835723_1071835728 -7 Left 1071835723 10:89415179-89415201 CCATCGCGACCCGACGGCTCTTC 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data
1071835723_1071835730 6 Left 1071835723 10:89415179-89415201 CCATCGCGACCCGACGGCTCTTC 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1071835730 10:89415208-89415230 GCGGCGACGGTGACCGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835723 Original CRISPR GAAGAGCCGTCGGGTCGCGA TGG (reversed) Intronic
901849379 1:12005895-12005917 GAACAGCCGTCGGGCCTTGATGG + Exonic
911987422 1:104645848-104645870 GAAGAGCCGTCTGGGCGCGGTGG + Intergenic
1069892951 10:71663261-71663283 GAAGAGCTGTCAGGTCCCCATGG - Intronic
1071835723 10:89415179-89415201 GAAGAGCCGTCGGGTCGCGATGG - Intronic
1081606747 11:44531890-44531912 GAAGAGCTGTCATGTCTCGAAGG + Intergenic
1093403607 12:18777592-18777614 GAAGAGCCCTTGGGCCTCGAGGG + Intergenic
1101640137 12:106581643-106581665 GCAGAGCCGGCGGGCCGCGGCGG - Intronic
1107754088 13:43600352-43600374 GAAGAGCCCTTGGGTCTTGAAGG + Intronic
1113807556 13:113118447-113118469 GCAGAGCCGGCGGGTGGCGCAGG + Exonic
1131922459 15:97344450-97344472 GAAGAACCGTAGGGTCTGGACGG - Intergenic
1132698257 16:1211464-1211486 GAAGAGCTGACGGGGTGCGACGG - Exonic
1136626363 16:31464569-31464591 GAGGAGCCTTGGGGACGCGAAGG + Exonic
1137300330 16:47143315-47143337 GAAGAGGGATCGGGTCGGGAAGG - Intronic
1149726049 17:58895757-58895779 GAAGTGCAGTCGTGTCGCTATGG - Intronic
1150002833 17:61452216-61452238 GAGGAGCCGGCGGCTCGCGTGGG + Intergenic
947457069 2:230265072-230265094 GAAGAGCCGTCAGGTGGGGGAGG + Intronic
966866302 3:184260747-184260769 GAAGAACCTTCGGGTCGAGAGGG - Intronic
990008623 5:50969583-50969605 GAAGAGACGTCTGGTCGAGGGGG + Intergenic
1057758485 9:97854632-97854654 CAAGAGCCGCCGGGCCCCGACGG - Exonic
1190078262 X:47334920-47334942 GAAGAGGGGACGGGGCGCGATGG + Intergenic