ID: 1071835724

View in Genome Browser
Species Human (GRCh38)
Location 10:89415183-89415205
Sequence CGCGACCCGACGGCTCTTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835718_1071835724 -2 Left 1071835718 10:89415162-89415184 CCGGAAGGCCTGTCCACCCATCG 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1071835724 10:89415183-89415205 CGCGACCCGACGGCTCTTCTCGG No data
1071835713_1071835724 13 Left 1071835713 10:89415147-89415169 CCGGGCGACGCTCCCCCGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1071835724 10:89415183-89415205 CGCGACCCGACGGCTCTTCTCGG No data
1071835715_1071835724 1 Left 1071835715 10:89415159-89415181 CCCCCGGAAGGCCTGTCCACCCA No data
Right 1071835724 10:89415183-89415205 CGCGACCCGACGGCTCTTCTCGG No data
1071835717_1071835724 -1 Left 1071835717 10:89415161-89415183 CCCGGAAGGCCTGTCCACCCATC 0: 1
1: 0
2: 2
3: 18
4: 212
Right 1071835724 10:89415183-89415205 CGCGACCCGACGGCTCTTCTCGG No data
1071835719_1071835724 -10 Left 1071835719 10:89415170-89415192 CCTGTCCACCCATCGCGACCCGA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1071835724 10:89415183-89415205 CGCGACCCGACGGCTCTTCTCGG No data
1071835716_1071835724 0 Left 1071835716 10:89415160-89415182 CCCCGGAAGGCCTGTCCACCCAT 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1071835724 10:89415183-89415205 CGCGACCCGACGGCTCTTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835724 Original CRISPR CGCGACCCGACGGCTCTTCT CGG Intronic
No off target data available for this crispr