ID: 1071835725

View in Genome Browser
Species Human (GRCh38)
Location 10:89415188-89415210
Sequence CGCTGCCGAGAAGAGCCGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 37}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835725_1071835736 25 Left 1071835725 10:89415188-89415210 CCCGACGGCTCTTCTCGGCAGCG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1071835736 10:89415236-89415258 GGCCGCCGCCTCCGGGAAACTGG No data
1071835725_1071835730 -3 Left 1071835725 10:89415188-89415210 CCCGACGGCTCTTCTCGGCAGCG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1071835730 10:89415208-89415230 GCGGCGACGGTGACCGTGCTGGG No data
1071835725_1071835731 4 Left 1071835725 10:89415188-89415210 CCCGACGGCTCTTCTCGGCAGCG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1071835731 10:89415215-89415237 CGGTGACCGTGCTGGGTCCGCGG No data
1071835725_1071835733 17 Left 1071835725 10:89415188-89415210 CCCGACGGCTCTTCTCGGCAGCG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1071835733 10:89415228-89415250 GGGTCCGCGGCCGCCGCCTCCGG No data
1071835725_1071835729 -4 Left 1071835725 10:89415188-89415210 CCCGACGGCTCTTCTCGGCAGCG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1071835729 10:89415207-89415229 AGCGGCGACGGTGACCGTGCTGG No data
1071835725_1071835734 18 Left 1071835725 10:89415188-89415210 CCCGACGGCTCTTCTCGGCAGCG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1071835734 10:89415229-89415251 GGTCCGCGGCCGCCGCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835725 Original CRISPR CGCTGCCGAGAAGAGCCGTC GGG (reversed) Intronic
903003563 1:20283572-20283594 CTCTGCCGACAAGAGCCTGCAGG - Intergenic
910277569 1:85465128-85465150 GGCTGCCAAGAGGAGCCGACGGG - Exonic
920208674 1:204312587-204312609 CGCTGCCGAGAAAAGGTGCCAGG - Intronic
924177795 1:241410567-241410589 TGCTGTTGAGAGGAGCCGTCTGG - Intergenic
1064018348 10:11790171-11790193 CGCTGCCCAGCAGAGCAGGCAGG - Intergenic
1070327988 10:75400350-75400372 CGATGCCAAGAAGAGCCCGCTGG - Exonic
1071835725 10:89415188-89415210 CGCTGCCGAGAAGAGCCGTCGGG - Intronic
1073287715 10:102398662-102398684 CCCTTCCCAGAAGAGCCCTCAGG - Intronic
1079056021 11:17207576-17207598 CGCTCCCGAGAAGAGGGGCCTGG + Intronic
1091387814 12:105760-105782 CCCTGCTGAGGAGAGCCCTCTGG - Intronic
1113774256 13:112933801-112933823 GGCTGCAGGGCAGAGCCGTCAGG - Intronic
1124703125 15:31934847-31934869 GCCTGCAGAGAAGAGCGGTCAGG - Intergenic
1140094099 16:71860401-71860423 CACGGCCAAGAAGAGCCGGCGGG - Exonic
1160900321 19:1424638-1424660 CGCGGCAGAGAAGGGCCGTGGGG - Intronic
1164207404 19:23070444-23070466 TGCAGCCGAGGAGAGCCATCTGG + Intergenic
936389201 2:112055946-112055968 GGCTGCAGGCAAGAGCCGTCAGG + Intronic
938489592 2:131754753-131754775 CGCCGCCGAGAAGCGCGGCCTGG + Intronic
946895392 2:224318721-224318743 CTCTGCAGTGAAGAGCCATCAGG + Intergenic
948014791 2:234679383-234679405 CACAGCACAGAAGAGCCGTCTGG - Intergenic
1177856486 21:26405953-26405975 CTCTGCTGAGAAGAGCCCTTGGG - Intergenic
1180967951 22:19800317-19800339 AACTGCAGAGAAGAGCCCTCCGG + Intronic
1182284193 22:29234326-29234348 CGCTGCCCAGCAGAGCCTTGGGG - Exonic
1184790357 22:46696163-46696185 AGCTGCCGGCAAGAGCAGTCTGG + Intronic
954108406 3:48421223-48421245 TGCTGCCGAGAGGAGCCGGTGGG - Exonic
964656785 3:159075965-159075987 AGCTTCAGAGAAGAGCCTTCTGG - Intronic
968661844 4:1801881-1801903 CGCTGCCCAGCACCGCCGTCTGG - Exonic
993966118 5:94363072-94363094 TGCTGATGAGAAGAGCCTTCTGG + Intronic
998554949 5:143114293-143114315 CTCTGTCGAGAACACCCGTCAGG - Intronic
1016751308 6:147633352-147633374 CGCAGCCCAAAAGAGCCCTCGGG - Intronic
1019442664 7:1055334-1055356 CGCTGCTGATAAGAGCCTGCGGG + Exonic
1021918039 7:25455242-25455264 CCCAGCCTAGCAGAGCCGTCAGG - Intergenic
1022091120 7:27108688-27108710 CGCTGGCGACAAGAGCCCGCCGG - Exonic
1031308023 7:120158460-120158482 CACTGCCAAGAAGAGCCATAAGG - Intergenic
1035129535 7:156639902-156639924 CGCTCCTGAGCAGAGCCTTCCGG - Exonic
1035388387 7:158489598-158489620 CGCTGCCGAGAGGAGGCGGATGG - Intronic
1036718894 8:11154043-11154065 CCTTGCCGAGAAGAGACATCTGG + Intronic
1062162413 9:135087672-135087694 CGCCACCGGGAAGCGCCGTCCGG - Intronic
1200049547 X:153421582-153421604 CGCGGCCGAGCACAGCCGCCAGG + Exonic