ID: 1071835726

View in Genome Browser
Species Human (GRCh38)
Location 10:89415189-89415211
Sequence CCGCTGCCGAGAAGAGCCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835726_1071835731 3 Left 1071835726 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1071835731 10:89415215-89415237 CGGTGACCGTGCTGGGTCCGCGG No data
1071835726_1071835730 -4 Left 1071835726 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1071835730 10:89415208-89415230 GCGGCGACGGTGACCGTGCTGGG No data
1071835726_1071835734 17 Left 1071835726 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1071835734 10:89415229-89415251 GGTCCGCGGCCGCCGCCTCCGGG No data
1071835726_1071835733 16 Left 1071835726 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1071835733 10:89415228-89415250 GGGTCCGCGGCCGCCGCCTCCGG No data
1071835726_1071835729 -5 Left 1071835726 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1071835729 10:89415207-89415229 AGCGGCGACGGTGACCGTGCTGG No data
1071835726_1071835736 24 Left 1071835726 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1071835736 10:89415236-89415258 GGCCGCCGCCTCCGGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835726 Original CRISPR CCGCTGCCGAGAAGAGCCGT CGG (reversed) Intronic
910277570 1:85465129-85465151 CGGCTGCCAAGAGGAGCCGACGG - Exonic
1063944674 10:11165254-11165276 CTGCTGTCGAGCAGAGCCGGGGG - Intronic
1064172878 10:13049741-13049763 AGGCTGCCCAGAAGAGCCCTGGG + Intronic
1069689765 10:70342598-70342620 CAGCTGCCTAGCAGAGCTGTTGG + Intronic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1078449153 11:11427485-11427507 ACTCAGCCGAGCAGAGCCGTCGG - Intronic
1102016673 12:109652641-109652663 CTGCTGCCGAGAAGCGCAGAAGG - Intergenic
1119225600 14:72942611-72942633 CGGCTGCCGGGAAGAGCCCCAGG - Intronic
1119225607 14:72942637-72942659 CCGCTGCTGGGAAGAGCCCCAGG - Intronic
1141579319 16:84986464-84986486 CGGCTGCCGAGAAGGCTCGTAGG + Intronic
1145235926 17:21208410-21208432 CCACTGCCAAGAAGAGCGGGAGG + Intronic
1150168446 17:62966497-62966519 CCGCCGCCGAGCCGAGCCGAGGG + Intergenic
1156936825 18:42719429-42719451 ACCCTGCCAAGAAGAGCAGTTGG - Intergenic
1158976565 18:62715927-62715949 CCGCTGCCGGGCAGAGCGGGGGG + Exonic
1159734171 18:72073791-72073813 CAGCTGCCCAGAAGACCAGTGGG - Intergenic
1159963257 18:74572257-74572279 CTGATGCCTAGAAGAGCTGTAGG - Intronic
1160900322 19:1424639-1424661 GCGCGGCAGAGAAGGGCCGTGGG - Intronic
1161209187 19:3057415-3057437 CCGCTGCCAAGGACAGCCGGGGG + Intronic
936307982 2:111359128-111359150 CCTGTGCCTGGAAGAGCCGTAGG - Intergenic
937485196 2:122308388-122308410 CCTCAGCCGAGAAGAGCAGCAGG - Intergenic
938630225 2:133158839-133158861 CCAGTGCCCAGAAGAGCAGTAGG - Intronic
941877303 2:170447117-170447139 CTGCTTCAGAGAAGAGCTGTGGG + Intronic
946725286 2:222655967-222655989 CTGCCTCCGAGAAGAGGCGTAGG + Intronic
948881265 2:240858449-240858471 ACGCTGCAGAGAAGTGCAGTGGG - Intergenic
1172864453 20:38084981-38085003 CCCTAGCCCAGAAGAGCCGTGGG - Intronic
1175851029 20:62093093-62093115 CCCCTGCCCAGCAGAGCCCTGGG + Intergenic
1177856487 21:26405954-26405976 ACTCTGCTGAGAAGAGCCCTTGG - Intergenic
1179544330 21:42104362-42104384 CCGCTGCCCAGAAGTGCTGGGGG - Intronic
1182284194 22:29234327-29234349 CCGCTGCCCAGCAGAGCCTTGGG - Exonic
1185018208 22:48358063-48358085 CAGCTGAGGAGAAGAGCCCTGGG - Intergenic
1185126478 22:49013891-49013913 TCGCTGCTGTGAAGAGCCGTGGG + Intergenic
950264409 3:11563556-11563578 CCTCTGCAGAGCAGAGCTGTGGG - Intronic
954108407 3:48421224-48421246 GTGCTGCCGAGAGGAGCCGGTGG - Exonic
969573439 4:8023322-8023344 TCGCAGCCGAGAGGAGCCTTGGG - Intronic
973926428 4:55743132-55743154 CAGCTGCTGAGAGGAGCCGCAGG + Intergenic
982189039 4:152834782-152834804 CCACTGCCTAGGAGAGCTGTGGG - Intronic
988180596 5:27786538-27786560 CCTCTGCCGGGTAGAGCTGTGGG - Intergenic
989711069 5:44398006-44398028 CCTCTGCCTAGAAAAGCCCTGGG + Intergenic
1001127899 5:169037041-169037063 CCTCTGCTCAGAAGAGCCCTTGG - Intronic
1001822022 5:174718074-174718096 CCAGTGCCCAGAAGAGCCTTTGG - Intergenic
1001889827 5:175329535-175329557 CCTCTGCATAGAGGAGCCGTGGG - Intergenic
1013406761 6:109850508-109850530 CCTCTGCTGAGATGACCCGTTGG - Intergenic
1016751309 6:147633353-147633375 CCGCAGCCCAAAAGAGCCCTCGG - Intronic
1019527919 7:1489074-1489096 GCGCTGCCCAGAAGAGCTGGGGG + Intronic
1028514035 7:91656749-91656771 CCTCTGCCGAACAGCGCCGTGGG + Intergenic
1038479980 8:27895195-27895217 CAGCTGCAGAGTAGAGCCCTAGG + Intronic
1041960254 8:63606719-63606741 CTGCTGCTGAGAAGAGCAGATGG - Intergenic
1048648577 8:136449699-136449721 CCTCTCCCTAGAAGACCCGTGGG - Intergenic
1049199306 8:141332065-141332087 CTGCTGCCGGGAAGGGCCCTGGG + Intergenic
1049451801 8:142666023-142666045 CGGCTGCCGGGAAGAGCAGAGGG - Exonic
1052362191 9:27573365-27573387 CGGCTGCCGGGAAGAGGCGCGGG - Intronic
1188006518 X:25019827-25019849 CCGGTGCTGGGAAGAGCCGGAGG + Intergenic