ID: 1071835727

View in Genome Browser
Species Human (GRCh38)
Location 10:89415189-89415211
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835715_1071835727 7 Left 1071835715 10:89415159-89415181 CCCCCGGAAGGCCTGTCCACCCA No data
Right 1071835727 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG No data
1071835721_1071835727 -9 Left 1071835721 10:89415175-89415197 CCACCCATCGCGACCCGACGGCT No data
Right 1071835727 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG No data
1071835713_1071835727 19 Left 1071835713 10:89415147-89415169 CCGGGCGACGCTCCCCCGGAAGG No data
Right 1071835727 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG No data
1071835717_1071835727 5 Left 1071835717 10:89415161-89415183 CCCGGAAGGCCTGTCCACCCATC No data
Right 1071835727 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG No data
1071835718_1071835727 4 Left 1071835718 10:89415162-89415184 CCGGAAGGCCTGTCCACCCATCG No data
Right 1071835727 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG No data
1071835716_1071835727 6 Left 1071835716 10:89415160-89415182 CCCCGGAAGGCCTGTCCACCCAT No data
Right 1071835727 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG No data
1071835719_1071835727 -4 Left 1071835719 10:89415170-89415192 CCTGTCCACCCATCGCGACCCGA No data
Right 1071835727 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type