ID: 1071835728

View in Genome Browser
Species Human (GRCh38)
Location 10:89415195-89415217
Sequence GCTCTTCTCGGCAGCGGCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835722_1071835728 -6 Left 1071835722 10:89415178-89415200 CCCATCGCGACCCGACGGCTCTT 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data
1071835716_1071835728 12 Left 1071835716 10:89415160-89415182 CCCCGGAAGGCCTGTCCACCCAT 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data
1071835723_1071835728 -7 Left 1071835723 10:89415179-89415201 CCATCGCGACCCGACGGCTCTTC 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data
1071835715_1071835728 13 Left 1071835715 10:89415159-89415181 CCCCCGGAAGGCCTGTCCACCCA No data
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data
1071835721_1071835728 -3 Left 1071835721 10:89415175-89415197 CCACCCATCGCGACCCGACGGCT 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data
1071835719_1071835728 2 Left 1071835719 10:89415170-89415192 CCTGTCCACCCATCGCGACCCGA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data
1071835718_1071835728 10 Left 1071835718 10:89415162-89415184 CCGGAAGGCCTGTCCACCCATCG 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data
1071835717_1071835728 11 Left 1071835717 10:89415161-89415183 CCCGGAAGGCCTGTCCACCCATC 0: 1
1: 0
2: 2
3: 18
4: 212
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data
1071835713_1071835728 25 Left 1071835713 10:89415147-89415169 CCGGGCGACGCTCCCCCGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835728 Original CRISPR GCTCTTCTCGGCAGCGGCGA CGG Intronic
No off target data available for this crispr