ID: 1071835731

View in Genome Browser
Species Human (GRCh38)
Location 10:89415215-89415237
Sequence CGGTGACCGTGCTGGGTCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835726_1071835731 3 Left 1071835726 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1071835731 10:89415215-89415237 CGGTGACCGTGCTGGGTCCGCGG No data
1071835718_1071835731 30 Left 1071835718 10:89415162-89415184 CCGGAAGGCCTGTCCACCCATCG 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1071835731 10:89415215-89415237 CGGTGACCGTGCTGGGTCCGCGG No data
1071835721_1071835731 17 Left 1071835721 10:89415175-89415197 CCACCCATCGCGACCCGACGGCT 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1071835731 10:89415215-89415237 CGGTGACCGTGCTGGGTCCGCGG No data
1071835723_1071835731 13 Left 1071835723 10:89415179-89415201 CCATCGCGACCCGACGGCTCTTC 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1071835731 10:89415215-89415237 CGGTGACCGTGCTGGGTCCGCGG No data
1071835725_1071835731 4 Left 1071835725 10:89415188-89415210 CCCGACGGCTCTTCTCGGCAGCG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1071835731 10:89415215-89415237 CGGTGACCGTGCTGGGTCCGCGG No data
1071835719_1071835731 22 Left 1071835719 10:89415170-89415192 CCTGTCCACCCATCGCGACCCGA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1071835731 10:89415215-89415237 CGGTGACCGTGCTGGGTCCGCGG No data
1071835722_1071835731 14 Left 1071835722 10:89415178-89415200 CCCATCGCGACCCGACGGCTCTT 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1071835731 10:89415215-89415237 CGGTGACCGTGCTGGGTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835731 Original CRISPR CGGTGACCGTGCTGGGTCCG CGG Intronic
No off target data available for this crispr