ID: 1071835732

View in Genome Browser
Species Human (GRCh38)
Location 10:89415221-89415243
Sequence CGGCGGCCGCGGACCCAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835732_1071835741 15 Left 1071835732 10:89415221-89415243 CCGTGCTGGGTCCGCGGCCGCCG No data
Right 1071835741 10:89415259-89415281 TCAGCGCCTGCAGAGCCCCCAGG No data
1071835732_1071835746 29 Left 1071835732 10:89415221-89415243 CCGTGCTGGGTCCGCGGCCGCCG No data
Right 1071835746 10:89415273-89415295 GCCCCCAGGCGCTGTTCCGGGGG No data
1071835732_1071835743 26 Left 1071835732 10:89415221-89415243 CCGTGCTGGGTCCGCGGCCGCCG No data
Right 1071835743 10:89415270-89415292 AGAGCCCCCAGGCGCTGTTCCGG 0: 1
1: 0
2: 0
3: 11
4: 134
1071835732_1071835745 28 Left 1071835732 10:89415221-89415243 CCGTGCTGGGTCCGCGGCCGCCG No data
Right 1071835745 10:89415272-89415294 AGCCCCCAGGCGCTGTTCCGGGG No data
1071835732_1071835744 27 Left 1071835732 10:89415221-89415243 CCGTGCTGGGTCCGCGGCCGCCG No data
Right 1071835744 10:89415271-89415293 GAGCCCCCAGGCGCTGTTCCGGG No data
1071835732_1071835736 -8 Left 1071835732 10:89415221-89415243 CCGTGCTGGGTCCGCGGCCGCCG No data
Right 1071835736 10:89415236-89415258 GGCCGCCGCCTCCGGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835732 Original CRISPR CGGCGGCCGCGGACCCAGCA CGG (reversed) Intronic