ID: 1071835732

View in Genome Browser
Species Human (GRCh38)
Location 10:89415221-89415243
Sequence CGGCGGCCGCGGACCCAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835732_1071835744 27 Left 1071835732 10:89415221-89415243 CCGTGCTGGGTCCGCGGCCGCCG 0: 1
1: 0
2: 0
3: 25
4: 119
Right 1071835744 10:89415271-89415293 GAGCCCCCAGGCGCTGTTCCGGG No data
1071835732_1071835736 -8 Left 1071835732 10:89415221-89415243 CCGTGCTGGGTCCGCGGCCGCCG 0: 1
1: 0
2: 0
3: 25
4: 119
Right 1071835736 10:89415236-89415258 GGCCGCCGCCTCCGGGAAACTGG No data
1071835732_1071835746 29 Left 1071835732 10:89415221-89415243 CCGTGCTGGGTCCGCGGCCGCCG 0: 1
1: 0
2: 0
3: 25
4: 119
Right 1071835746 10:89415273-89415295 GCCCCCAGGCGCTGTTCCGGGGG No data
1071835732_1071835743 26 Left 1071835732 10:89415221-89415243 CCGTGCTGGGTCCGCGGCCGCCG 0: 1
1: 0
2: 0
3: 25
4: 119
Right 1071835743 10:89415270-89415292 AGAGCCCCCAGGCGCTGTTCCGG No data
1071835732_1071835745 28 Left 1071835732 10:89415221-89415243 CCGTGCTGGGTCCGCGGCCGCCG 0: 1
1: 0
2: 0
3: 25
4: 119
Right 1071835745 10:89415272-89415294 AGCCCCCAGGCGCTGTTCCGGGG No data
1071835732_1071835741 15 Left 1071835732 10:89415221-89415243 CCGTGCTGGGTCCGCGGCCGCCG 0: 1
1: 0
2: 0
3: 25
4: 119
Right 1071835741 10:89415259-89415281 TCAGCGCCTGCAGAGCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835732 Original CRISPR CGGCGGCCGCGGACCCAGCA CGG (reversed) Intronic
900786695 1:4654445-4654467 CGGCGACCCCGGCCCCCGCAAGG + Intergenic
900970820 1:5991806-5991828 CGGAGTCCGCGGACCCCGCCTGG - Intronic
902169582 1:14599120-14599142 CGGCGGCGGCGGCCCCGGCCCGG + Exonic
904541989 1:31239583-31239605 CGGCGGCCGCGGAGCAAGAAGGG - Intergenic
905031229 1:34885661-34885683 CGGCGGCCGAGGGCCCCGCCCGG - Exonic
905461699 1:38126535-38126557 CAGCCCCCGGGGACCCAGCAGGG - Intergenic
905670714 1:39788622-39788644 CGGCGACCGCGGCCTCAGCGCGG + Exonic
906627082 1:47334068-47334090 CGGCGGCCCCGGCGCCGGCAAGG + Exonic
906650363 1:47508461-47508483 CCGCGGCCGCAGGCCCGGCACGG + Intergenic
910771470 1:90836099-90836121 CTGCGGCCGCGGACCCTGGATGG - Intergenic
913518366 1:119623685-119623707 CGGCGGCAGCGGCCTCAGCCAGG + Exonic
915555808 1:156660115-156660137 AGGGCGCCGCGGACCCAGCACGG + Intergenic
920705044 1:208244430-208244452 CAGCGGGCGCGGCCCCAGCCCGG - Intergenic
921944983 1:220880046-220880068 CGGCGGCCGAGGCCCCTGCCAGG - Exonic
922696790 1:227734983-227735005 CGGCGGCCGCAGACCCCGGGCGG - Exonic
1067145424 10:43690251-43690273 GGGCGGCCGTGGAACAAGCAGGG + Intergenic
1069876600 10:71566945-71566967 GGACGGCCGGGGCCCCAGCATGG - Intronic
1071835732 10:89415221-89415243 CGGCGGCCGCGGACCCAGCACGG - Intronic
1072283786 10:93894125-93894147 CGGCGGCCGCCGAGGCAGCTGGG + Exonic
1075712916 10:124540339-124540361 TTGCGGCCGGGGACCCAGCCTGG + Intronic
1076682790 10:132182805-132182827 CGGTGGCTGCGGACCAGGCATGG + Exonic
1077419948 11:2445328-2445350 CGGCGGCCGCGGGCCAAGGTCGG - Exonic
1083627178 11:64077784-64077806 CGGCGGCCGGAGGCCCAGCCAGG - Intronic
1087634564 11:100687639-100687661 CGGCGGCCGCGGACACGTCCGGG - Intronic
1090640487 11:128725443-128725465 AGGCAGCCAGGGACCCAGCATGG + Intronic
1092933374 12:13338113-13338135 CAGCGCCCTCGGACCCAGCTTGG - Intergenic
1094048671 12:26195719-26195741 CGCCGGCCGCGGACGCCGCTGGG + Exonic
1094192401 12:27710848-27710870 CGGCCGCCGCGCTCCCAGCATGG + Exonic
1096143757 12:49264477-49264499 GGGCGCCCGCGGGCCCAGCCGGG + Intronic
1096460795 12:51820690-51820712 CAGCGGGCGCTGGCCCAGCAGGG - Intergenic
1097153179 12:56994521-56994543 GGGCGGCCGTGAAGCCAGCAGGG + Exonic
1100565482 12:95790439-95790461 CGGCGACCGCTGACCGAGCCCGG - Exonic
1103595486 12:122022362-122022384 CAGCGGCCGCGGCCCCAGCCTGG - Intronic
1104897689 12:132172347-132172369 CGGCGGCTGAGCACCCAGGAGGG + Intergenic
1106248726 13:27968556-27968578 CGGTGGCGGCGGGCCCAGGAGGG + Exonic
1110860426 13:80340578-80340600 CGCCGGCCGCGGCGCCAGGAGGG + Intronic
1113841485 13:113363970-113363992 CGGCGGCTGCGGTCCCCGCGCGG - Intronic
1115855071 14:37622307-37622329 GGGCGGCCGCGGACATCGCAGGG - Intronic
1121127514 14:91417687-91417709 CGGCGGGCGCAGCCTCAGCATGG - Exonic
1121468919 14:94136812-94136834 CAGCTGCCGCGGGCCCAGCTAGG - Intergenic
1121767872 14:96502810-96502832 CGACGGCAGCTGACCCAGCCAGG - Intronic
1122372627 14:101237055-101237077 TGGGGGCTGCGGACTCAGCATGG + Intergenic
1122543297 14:102509491-102509513 CGGCGGCCGCGGGCGCGGCGCGG + Intronic
1125716120 15:41820935-41820957 CAGCTGCCGCAGATCCAGCATGG - Exonic
1128154291 15:65383112-65383134 CGGCAGCCGCGGATACAGGAAGG + Exonic
1131827049 15:96330504-96330526 TGGCGGCCGCGGGCGCAGCCCGG - Intronic
1132889529 16:2196873-2196895 CGGCGGCCGCGTCCCCAGCCCGG - Intergenic
1136110983 16:28063545-28063567 CGGCGGCGGCGGACGCGGCGCGG + Intergenic
1136235439 16:28910928-28910950 CAGCTGCTGCGGACCCTGCAAGG - Exonic
1136419621 16:30123408-30123430 TGGAGGCCGCGGAGCCCGCAGGG - Intronic
1136711571 16:32241237-32241259 CGGCGGCCGCGGCCCAGGCAGGG - Intergenic
1136756344 16:32688168-32688190 CGGCGGCCGCGGCCCAGGCAGGG + Intergenic
1136811768 16:33182206-33182228 CGGCGGCCGCGGCCCAGGCAGGG - Intergenic
1136818244 16:33292286-33292308 CGGCGGCCGCGGCCCAGGCAGGG - Intronic
1136824808 16:33348819-33348841 CGGCGGCCGCGGCCCAGGCAGGG - Intergenic
1136829874 16:33447590-33447612 CGGCGGCCGCGGCCCAGGCAGGG - Intergenic
1137707991 16:50548535-50548557 CGGCCGCCGCAGCCCCAGCATGG + Exonic
1139472252 16:67184508-67184530 CGGCGGCAGCGCAGCCTGCAGGG + Exonic
1140440644 16:74985028-74985050 CGGCCGCCGCGGCCCCAGGACGG + Exonic
1141430525 16:83968508-83968530 CCGCGGCCGCGGACACCGCGGGG - Intergenic
1142287206 16:89176317-89176339 GGGCAGCCTCGGAGCCAGCAGGG + Intronic
1202990346 16_KI270728v1_random:5174-5196 CGGCGGCCGCGGCCCAGGCAGGG - Intergenic
1203058483 16_KI270728v1_random:948522-948544 CGGCGGCCGCGGCCCAGGCAGGG + Intergenic
1142586566 17:978612-978634 CGGTGGCCGCGAACTCAGCCTGG + Intronic
1142587024 17:979981-980003 CGGCAGCTGCGGACCCCGCCTGG - Intergenic
1143321453 17:6071293-6071315 CGGAGGCAGGGGACCCAGCCAGG - Intronic
1147044252 17:37742106-37742128 CGCCGGCCGCGGCGCCCGCAGGG + Intronic
1150283053 17:63940537-63940559 CAGGGGCCTCAGACCCAGCATGG + Exonic
1151828871 17:76538207-76538229 CGGCCGCCGTGGACCTAGCTGGG + Intronic
1152263946 17:79282613-79282635 GGCCGGCCGCTGACCCAGAAGGG + Intronic
1152758756 17:82097837-82097859 GGGAGGCCGCGGACCCTGAAGGG - Intronic
1152794249 17:82299055-82299077 CGGTGGCCTCGGGCCCTGCAGGG + Intergenic
1152864904 17:82716726-82716748 CCGCGGCCGCGGACCCGCCCCGG - Exonic
1154057264 18:11023932-11023954 CGGCGGCCCCGCACTCAGAACGG - Intronic
1155053099 18:22165140-22165162 CGGCGGCCGCAGACCTCGGACGG - Intergenic
1160514314 18:79470070-79470092 CGGCGTCCTCAGACCCAGCCGGG - Intronic
1160719164 19:589998-590020 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1160908852 19:1465659-1465681 CGGTGGCCGCGGCCGCAGCCAGG - Exonic
1161333825 19:3700430-3700452 CGGCGGCGGCGGTCGCAGCTCGG - Exonic
1161337296 19:3721553-3721575 CGGCGGCCGCGGCCAGAGCCCGG - Intronic
1161851410 19:6739743-6739765 CGGCGGCGGCGGGAGCAGCATGG + Exonic
1162648185 19:12065100-12065122 CGGCGACTGCGGCCCCAGCCCGG + Intronic
1162778658 19:12995633-12995655 CGGCGGCCCCGGAGCCGGCGGGG + Exonic
1166528374 19:43527128-43527150 CGGCGGCAGCTGAGCCAGCGCGG - Exonic
929174221 2:38960501-38960523 CGGCGGCCGCGCGCCCATCAAGG + Exonic
929218116 2:39437111-39437133 CGGCGGCGGCGGCCGCAGCGTGG - Exonic
933907992 2:86914106-86914128 CGGCGGCCTCGGCCCCGGCCTGG + Intronic
936452722 2:112645747-112645769 CGGCGGCCACGCCCCCAGCGGGG - Intergenic
940454053 2:153873307-153873329 CAGCGCCCTCGGACCCGGCAAGG - Intronic
942083990 2:172427715-172427737 CGGCAGCCTCGGACCCAGCCCGG + Intronic
942241244 2:173965119-173965141 CGGCGGCGGCGGCAGCAGCAAGG + Intronic
944221683 2:197310292-197310314 CGGCGGCCGCGGGCCCGGCGGGG - Intronic
947605762 2:231484128-231484150 GGGGGCCCGCGGACCCAGCGTGG + Intergenic
949032529 2:241803856-241803878 CAGCCGCCGCGGCCCCAGCTCGG - Exonic
1168761051 20:349673-349695 CTGCAGCCGCGGCCCCAGCGTGG + Exonic
1169231143 20:3889549-3889571 AGGCGGCCGGGGACCCCGAAGGG + Exonic
1172474488 20:35226764-35226786 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1172771332 20:37384288-37384310 CGGCCACCGCGGCCCCAGCGCGG + Exonic
1175624879 20:60481894-60481916 GGGCAGCAGCGAACCCAGCAAGG + Intergenic
1176308195 21:5135356-5135378 CAGCCTCCGCGGCCCCAGCACGG - Intronic
1176382127 21:6118823-6118845 CTGCGGCTGCGGGCACAGCAAGG - Exonic
1179522405 21:41953831-41953853 CGGCGGCCGCGGCCCGGGCTGGG + Exonic
1179741345 21:43419416-43419438 CTGCGGCTGCGGGCACAGCAAGG + Exonic
1179848865 21:44126676-44126698 CAGCCTCCGCGGCCCCAGCACGG + Intronic
1181513697 22:23400108-23400130 CTGGGGCCGGGGGCCCAGCACGG + Intergenic
1181669654 22:24420258-24420280 CGGCGGCGGCGGGGCCAGCTGGG - Intronic
955987364 3:64587930-64587952 TGGAGGCCAAGGACCCAGCAGGG + Intronic
956678028 3:71753682-71753704 CGGCGGCGGCGGGCCCGGCGGGG + Intronic
961483284 3:127197379-127197401 AGGCGGCGGCGGGCCCTGCAGGG - Exonic
961858181 3:129893441-129893463 CGGCGGTCGCGGCCCCCTCACGG - Intronic
963904489 3:150762744-150762766 CGGCGGCCGGGGGCGCAGCCGGG + Exonic
968472173 4:787173-787195 ATGCGGCCGCGGCCCCAGCAGGG + Intronic
968674734 4:1871421-1871443 CGGCGGCGGCGGGCGCAGCGCGG - Intronic
968965303 4:3766435-3766457 CGCCGCCCGCGGAGCCACCACGG + Exonic
972725870 4:41746091-41746113 CGGCGGCGGCGGGCCCAGCCCGG - Exonic
973613579 4:52658958-52658980 CTGCGGCCGCGCGCCCAGCTCGG + Intronic
980969405 4:139555610-139555632 CGGCGGCCGCGGCCCCGTCCGGG - Intronic
985190481 4:187367128-187367150 CGGAGACTGCGGACCCAGCGTGG + Intergenic
985790664 5:1925408-1925430 CGGTGGCCGCAGTCCCAGCAAGG - Intergenic
990545298 5:56815851-56815873 CGGAGCCCGCGGACGCAGCGGGG + Exonic
998157631 5:139795693-139795715 CGGCGGGCGCGGAGCCCGGAGGG - Intergenic
998849345 5:146338829-146338851 CGGCCGCCGCGGGCGCAGAAAGG + Intronic
1002320474 5:178372512-178372534 CGGGGGCTGCGGTCCCTGCAAGG + Intronic
1003645306 6:7909883-7909905 CGGTGGCCGCGGCAGCAGCAAGG + Intronic
1006814166 6:36839556-36839578 CGGGGGCCGCGGATCGAGGAGGG + Exonic
1017962528 6:159233950-159233972 CCGCGCCCGGGTACCCAGCAGGG + Exonic
1020105657 7:5421193-5421215 CGGCGGCGGGGGACCGTGCACGG + Exonic
1024043846 7:45574514-45574536 CCGCGGCCGCGGCCGCTGCATGG + Exonic
1033406373 7:141074033-141074055 CGGCGGCGGCGAACCCAGCGCGG - Intergenic
1035854817 8:2963373-2963395 CGGCGGCTGAGGACACAGCACGG + Exonic
1037529199 8:19757289-19757311 CGGCAGCCGCGGAGCCTCCAGGG + Intronic
1048981625 8:139705660-139705682 GGGCGCCCGCAGACCCAGCGAGG - Intergenic
1049558623 8:143296435-143296457 CGGCACCGGCGGACCCACCACGG + Exonic
1049785312 8:144448029-144448051 CGGTGGCCGAGGACCCACCGTGG + Intergenic
1057772785 9:97983193-97983215 CGGCGGCCGCGGCTGCACCAAGG - Intergenic
1062238744 9:135524882-135524904 AGGAGCCCGCGGACTCAGCACGG + Exonic
1062520458 9:136955549-136955571 AGGCGACCGCTGACCCTGCAGGG + Intronic
1062574154 9:137198815-137198837 CTGGGGCCCTGGACCCAGCACGG + Intronic
1062601633 9:137321013-137321035 CAGAGGCCGCGGTCCCCGCAGGG + Intronic
1062726268 9:138075768-138075790 CGGCTCCTGCAGACCCAGCAGGG + Intronic
1185781894 X:2855036-2855058 CTGCGGCCCCGGACCCCGGATGG + Exonic
1189262557 X:39688957-39688979 CGGCGCGCTCGGAGCCAGCAGGG + Intergenic
1190714007 X:53088772-53088794 CGCCCGCAGCGGACCCAGCCAGG + Intergenic
1196464346 X:115957924-115957946 CTGGGGCCGAGGACCCAGCTAGG + Intergenic
1198750462 X:139932676-139932698 CGGCAGCCGCGGACCGAGGAGGG - Intronic