ID: 1071835733

View in Genome Browser
Species Human (GRCh38)
Location 10:89415228-89415250
Sequence GGGTCCGCGGCCGCCGCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835726_1071835733 16 Left 1071835726 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1071835733 10:89415228-89415250 GGGTCCGCGGCCGCCGCCTCCGG No data
1071835721_1071835733 30 Left 1071835721 10:89415175-89415197 CCACCCATCGCGACCCGACGGCT 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1071835733 10:89415228-89415250 GGGTCCGCGGCCGCCGCCTCCGG No data
1071835722_1071835733 27 Left 1071835722 10:89415178-89415200 CCCATCGCGACCCGACGGCTCTT 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1071835733 10:89415228-89415250 GGGTCCGCGGCCGCCGCCTCCGG No data
1071835725_1071835733 17 Left 1071835725 10:89415188-89415210 CCCGACGGCTCTTCTCGGCAGCG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1071835733 10:89415228-89415250 GGGTCCGCGGCCGCCGCCTCCGG No data
1071835723_1071835733 26 Left 1071835723 10:89415179-89415201 CCATCGCGACCCGACGGCTCTTC 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1071835733 10:89415228-89415250 GGGTCCGCGGCCGCCGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835733 Original CRISPR GGGTCCGCGGCCGCCGCCTC CGG Intronic
No off target data available for this crispr