ID: 1071835734

View in Genome Browser
Species Human (GRCh38)
Location 10:89415229-89415251
Sequence GGTCCGCGGCCGCCGCCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835723_1071835734 27 Left 1071835723 10:89415179-89415201 CCATCGCGACCCGACGGCTCTTC 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1071835734 10:89415229-89415251 GGTCCGCGGCCGCCGCCTCCGGG No data
1071835726_1071835734 17 Left 1071835726 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1071835734 10:89415229-89415251 GGTCCGCGGCCGCCGCCTCCGGG No data
1071835722_1071835734 28 Left 1071835722 10:89415178-89415200 CCCATCGCGACCCGACGGCTCTT 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1071835734 10:89415229-89415251 GGTCCGCGGCCGCCGCCTCCGGG No data
1071835725_1071835734 18 Left 1071835725 10:89415188-89415210 CCCGACGGCTCTTCTCGGCAGCG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1071835734 10:89415229-89415251 GGTCCGCGGCCGCCGCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835734 Original CRISPR GGTCCGCGGCCGCCGCCTCC GGG Intronic
No off target data available for this crispr