ID: 1071835736

View in Genome Browser
Species Human (GRCh38)
Location 10:89415236-89415258
Sequence GGCCGCCGCCTCCGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071835725_1071835736 25 Left 1071835725 10:89415188-89415210 CCCGACGGCTCTTCTCGGCAGCG No data
Right 1071835736 10:89415236-89415258 GGCCGCCGCCTCCGGGAAACTGG No data
1071835726_1071835736 24 Left 1071835726 10:89415189-89415211 CCGACGGCTCTTCTCGGCAGCGG No data
Right 1071835736 10:89415236-89415258 GGCCGCCGCCTCCGGGAAACTGG No data
1071835732_1071835736 -8 Left 1071835732 10:89415221-89415243 CCGTGCTGGGTCCGCGGCCGCCG No data
Right 1071835736 10:89415236-89415258 GGCCGCCGCCTCCGGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071835736 Original CRISPR GGCCGCCGCCTCCGGGAAAC TGG Intronic