ID: 1071836338

View in Genome Browser
Species Human (GRCh38)
Location 10:89421821-89421843
Sequence CTTGGGCCTGCCTGTGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071836338_1071836345 18 Left 1071836338 10:89421821-89421843 CCTACAACACAGGCAGGCCCAAG No data
Right 1071836345 10:89421862-89421884 TATGTTCATTACTGAGATTAAGG No data
1071836338_1071836340 -7 Left 1071836338 10:89421821-89421843 CCTACAACACAGGCAGGCCCAAG No data
Right 1071836340 10:89421837-89421859 GCCCAAGGATAGTCCCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071836338 Original CRISPR CTTGGGCCTGCCTGTGTTGT AGG (reversed) Intergenic
No off target data available for this crispr