ID: 1071841286

View in Genome Browser
Species Human (GRCh38)
Location 10:89474351-89474373
Sequence CTGAACCAGGCAGTGTGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 271}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071841286 Original CRISPR CTGAACCAGGCAGTGTGTTT GGG (reversed) Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
901357676 1:8665378-8665400 CTGTGCCAGGCAGTGAGTTAAGG - Intronic
902758422 1:18564909-18564931 CTGAACCATGCAGGCTGTGTCGG + Intergenic
904294853 1:29513567-29513589 CTGAACCAGTCACTGTGGCTGGG + Intergenic
904822361 1:33254409-33254431 CTGCACCCGGCCGTGTCTTTAGG + Intergenic
904822455 1:33255101-33255123 CTGTGCCAGGCACTGTGCTTGGG + Intergenic
905448991 1:38045396-38045418 CTGAGCCGGGCAGTGTGTGGTGG + Exonic
905463400 1:38135672-38135694 ATGAGCCAGGCACCGTGTTTGGG + Intergenic
905869361 1:41394425-41394447 CAAAACCAGACAGTGTGTTTAGG + Intergenic
906024946 1:42665481-42665503 CTGAACCAGGATTTGTGTCTGGG + Intronic
906457194 1:46007311-46007333 CTGAACCAGTCATTGTGGTCTGG - Intronic
906566199 1:46802945-46802967 CTGGAAAAAGCAGTGTGTTTAGG + Intronic
907556731 1:55350600-55350622 CTGAAGGAGACAGTGTGTCTAGG + Intergenic
907707317 1:56844081-56844103 CTGTGCCAGGCAGTGTGCTGGGG + Intergenic
908784375 1:67720596-67720618 CTGTGCCAGGCACTGTGTTAAGG + Intronic
909234179 1:73130397-73130419 GTGGACCAGCCCGTGTGTTTGGG + Intergenic
912705381 1:111907916-111907938 CTAAGACAGGCAGTGTGTTCTGG - Intronic
915666706 1:157451647-157451669 CTGACACACGCAGTGTGTTTAGG - Intergenic
915915588 1:159938533-159938555 CTGAGCCTGGCAGTGTGGTGTGG - Intronic
916261532 1:162847148-162847170 CTGATGCAGGCACTGTGCTTGGG - Intronic
916989606 1:170227974-170227996 CTGAAGCAGGAAGACTGTTTGGG + Intergenic
917418420 1:174835973-174835995 CTGAACCATGCAGTCATTTTAGG - Intronic
919864276 1:201767924-201767946 CTGAACAAGGGAATATGTTTTGG - Intronic
919995898 1:202750143-202750165 CTGAACTAAGCAGTATGCTTAGG + Intronic
920234493 1:204494013-204494035 CTGAACCAGTCAATGGCTTTGGG - Intronic
920964000 1:210687320-210687342 CTGAACCAGCCAGCGTATTCAGG + Intronic
921976013 1:221204160-221204182 CTTAATTAGGGAGTGTGTTTTGG + Intergenic
922080377 1:222290021-222290043 TTGAAACTGGCAGTGTGTTATGG - Intergenic
923496149 1:234526573-234526595 CTGAAGCAGGGAGTGAGCTTGGG - Intergenic
923921498 1:238569461-238569483 CTGGGCCATGCATTGTGTTTCGG - Intergenic
924121751 1:240807122-240807144 AAGAACCTGGGAGTGTGTTTTGG + Intronic
924221767 1:241884325-241884347 ATGAATCTGGCAGTGTGTGTAGG - Intronic
1063917455 10:10897967-10897989 CTGAACCAGTCACTGTTTCTGGG - Intergenic
1064013451 10:11754890-11754912 CTGAACCAGGCACTGTAATTTGG - Intronic
1065375199 10:25032579-25032601 CTGAACCAGGAGGTGGGTTTGGG - Intronic
1067081184 10:43213277-43213299 CTGATCAAGGCAGGGTATTTGGG - Intronic
1071119213 10:82258666-82258688 TTCAAACAGGCAGTGTGTTAAGG + Intronic
1071823104 10:89297738-89297760 GTGAAGCAGGCTGTGTGCTTGGG + Intronic
1071841286 10:89474351-89474373 CTGAACCAGGCAGTGTGTTTGGG - Intronic
1072744217 10:97928614-97928636 CAGAACCAGACAGTATGTCTGGG + Intronic
1073191344 10:101652462-101652484 CAAAACCAGGCAGTGGGATTTGG - Intronic
1073772968 10:106755646-106755668 TTGAACCATGCAGTTTGATTAGG + Intronic
1074213442 10:111360430-111360452 CTGGAGCATGCAGTGTGTTCTGG - Intergenic
1074446231 10:113523245-113523267 CTCCACCAGGAAGTGTGGTTGGG + Intergenic
1075664859 10:124222885-124222907 CTGTAACAGGGAGTGTGTTCAGG + Intergenic
1076415972 10:130288834-130288856 CTGAACAAGGCAGTGTGTGTTGG - Intergenic
1077311508 11:1890894-1890916 CTGACCCAGGCTGTGTACTTGGG - Intronic
1078534659 11:12163301-12163323 CTGGTGCAGGCTGTGTGTTTAGG + Intronic
1078768058 11:14318714-14318736 CTGAGGAAGGCAGAGTGTTTAGG + Intronic
1080339341 11:31241662-31241684 GTGTTCCAGGCAGTGTATTTCGG - Intronic
1081250955 11:40832898-40832920 TTTATCAAGGCAGTGTGTTTTGG + Intronic
1082837191 11:57659879-57659901 CTCAACTACGCAGTGCGTTTGGG + Exonic
1082887923 11:58108004-58108026 ATGAGGCAGGCACTGTGTTTAGG + Intronic
1085393192 11:76193037-76193059 AGGACCCAGGGAGTGTGTTTGGG + Intronic
1087409648 11:97775595-97775617 GAAAACCAGGCAGTCTGTTTTGG + Intergenic
1087626093 11:100597800-100597822 CTGAAGCAGAAAATGTGTTTTGG + Intergenic
1088509910 11:110563849-110563871 CTGAGCCAGGCCTTGAGTTTAGG - Intergenic
1089630484 11:119781225-119781247 CTGACCCAGGCATGGTGTTTGGG + Intergenic
1089725796 11:120478567-120478589 CTGAACCAGGCAGGGGGGTGGGG - Intronic
1090384507 11:126348780-126348802 CTGAGCCAGGTAGTGTCTTAGGG - Intergenic
1090632207 11:128659580-128659602 CTGAACCAATCACTGTGGTTGGG + Intergenic
1092405999 12:8222461-8222483 CTGGAGCAGGCCGTGGGTTTTGG + Exonic
1093205851 12:16248153-16248175 CTGAATCAGGAGTTGTGTTTTGG + Intronic
1093224691 12:16467790-16467812 CTGAAGCAGACACTCTGTTTGGG - Intronic
1094581331 12:31736522-31736544 CTGAATCAGACAGTTTGTTTGGG - Intergenic
1095736799 12:45566441-45566463 CTGTGCCAGGCATTGTGTTAAGG + Intergenic
1096444287 12:51674750-51674772 CTGTACCAGCCACTGTGTTAAGG + Intronic
1096541106 12:52307710-52307732 TTGAGCCAGGCATTGTTTTTAGG + Intronic
1101037561 12:100720191-100720213 CTGAACCAGGAAGGGCGTTGTGG + Intronic
1101293664 12:103397969-103397991 ATGATCAAGTCAGTGTGTTTGGG - Intronic
1103749190 12:123147877-123147899 ATGCACCATGCAGTGTGCTTGGG - Intronic
1107114136 13:36728200-36728222 CTGTACCAGGCACTGTGTCAGGG - Intergenic
1107193132 13:37614029-37614051 CTGAAAAAGGGAGTGTGTGTGGG + Intergenic
1107390920 13:39963152-39963174 CTGAAACTTGAAGTGTGTTTTGG + Intergenic
1109559465 13:64027943-64027965 ATGAACCAGGCACTATGTATGGG + Intergenic
1110266738 13:73546572-73546594 CTAAACCAGGCAGCGTGGATTGG - Intergenic
1110512313 13:76365541-76365563 CTGACCCAGGCTGTGTGTGAGGG - Intergenic
1111180507 13:84657407-84657429 CTGACCATAGCAGTGTGTTTGGG - Intergenic
1112362171 13:98728064-98728086 CTGGTCCAGGCAGTGTGCTTTGG + Intronic
1112605328 13:100898995-100899017 CTGAACCGAACAGTGTGATTTGG + Intergenic
1114615139 14:24064355-24064377 CTGAAAATGGGAGTGTGTTTAGG - Intronic
1114812344 14:25915757-25915779 CTGAGCCAGGCAGAGTATATGGG + Intergenic
1118071904 14:62254692-62254714 CTGAGCCAAGCAGTGTGCTATGG - Intergenic
1118161629 14:63296654-63296676 CTGAATAGGGCAGTATGTTTGGG + Intergenic
1118630291 14:67696249-67696271 CTGAACCAGGCACTGGACTTGGG - Intergenic
1119922811 14:78462084-78462106 CTGCAACAGGCATTGTGCTTGGG - Intronic
1120879962 14:89407916-89407938 CTGAATCAGGATGTGTGTTATGG + Intronic
1121333048 14:93059941-93059963 CAGAGCCAGGCAGTGTGGATGGG - Intronic
1121426754 14:93857761-93857783 CTGAGAGAGGAAGTGTGTTTGGG + Intergenic
1122364526 14:101186728-101186750 ATGAATCTGGCAGTGTGTCTTGG + Intergenic
1124103093 15:26713473-26713495 CTGAACCCAGCATTGTGTTTCGG - Intronic
1124122956 15:26907687-26907709 CTGAACCTGGCAGTGGCCTTTGG + Intronic
1126755218 15:51919288-51919310 CTGATCTAGGCAGTGTCTGTGGG - Intronic
1127866366 15:63036550-63036572 TTAACCCAGGCAGTATGTTTGGG - Intergenic
1128687360 15:69696698-69696720 CTGCATCAGGCACTGTGTTTGGG + Intergenic
1128811575 15:70576834-70576856 CTGAAACATGCAGAGTGTTTGGG + Intergenic
1129192197 15:73944009-73944031 CTGAACTAAGCAGAGTGATTAGG + Intronic
1130529725 15:84737268-84737290 CTGAACCAGGCATTATGCTAGGG + Intergenic
1130866966 15:87941539-87941561 ATGAACCAGGCACTGTGATGGGG - Intronic
1132050836 15:98606491-98606513 CTGACCCAGGCATTGTCTGTGGG + Intergenic
1133431175 16:5738237-5738259 ATGATCAAGGCAGGGTGTTTAGG + Intergenic
1133749176 16:8711595-8711617 CTGAACCAGGGAGAGGATTTGGG + Intronic
1133962139 16:10503768-10503790 CTGCGCCTGGCTGTGTGTTTTGG - Intergenic
1136633030 16:31500273-31500295 CTCAACCAGGCCATGTGTTCAGG - Intronic
1137606526 16:49790370-49790392 CTGAGCCAGGCACTGTGCTGGGG + Intronic
1138269021 16:55681368-55681390 CTGAGCCAGGCAGTGTGCCGGGG - Intronic
1138984573 16:62312534-62312556 CTGAACCAATCACTGTGGTTAGG - Intergenic
1139162609 16:64529244-64529266 CTGTATCAGGTATTGTGTTTAGG - Intergenic
1139915356 16:70424931-70424953 CTGGACCAGGCACTGTGGCTGGG + Intronic
1141377202 16:83542420-83542442 CTGAATCAGGCAGTGTGGGGAGG - Intronic
1143687817 17:8533176-8533198 GTGAAACAGGCAGTGTGTTTTGG - Intronic
1143855078 17:9842510-9842532 CTGAGCCAAGCAGTGTCTGTAGG - Exonic
1144052817 17:11511575-11511597 CTGAACCAGGCATTTTTTTGGGG - Intronic
1144782788 17:17816301-17816323 CTGAACCTGGCAGAGTGTGCAGG - Exonic
1147317127 17:39626440-39626462 CATAGCCAGGGAGTGTGTTTTGG - Intergenic
1147357998 17:39912552-39912574 CTGCCCCAGGGAGGGTGTTTTGG - Intronic
1147378662 17:40038800-40038822 CTGAACAGAGCAGTGTATTTTGG - Intronic
1147668229 17:42162237-42162259 CTGAACCAGGAGGTGGGTTGGGG - Exonic
1148559742 17:48599029-48599051 TAGAACCAGGCAGAATGTTTTGG - Intronic
1149257304 17:54841211-54841233 CTGAAGCAGGCTGATTGTTTGGG - Intergenic
1155653429 18:28168715-28168737 CTTAACCAAGCATTATGTTTTGG + Intronic
1156807816 18:41208188-41208210 CTGATCCGGGCACTGTGGTTAGG + Intergenic
1157076041 18:44468807-44468829 CTGACCCAGGCATTGAGTCTGGG - Intergenic
1157709310 18:49838698-49838720 TTGAACCAAGCAGTGTACTTGGG - Intronic
1158755287 18:60316805-60316827 CTGAAACAGGATGTGTGATTGGG - Intergenic
1160484201 18:79273322-79273344 CTCACCCAGGGAGAGTGTTTGGG + Intronic
1161048610 19:2150631-2150653 CGGAACCAGGCAGGGTCTTGGGG - Intronic
1161236326 19:3200024-3200046 CTGAACCAGGCAGAGTGCGGAGG + Intronic
1162145196 19:8609017-8609039 ATGAACAAGGCAGTGGGTCTGGG + Intronic
1164956239 19:32388651-32388673 CTGACTTAGGTAGTGTGTTTTGG + Intergenic
1165118390 19:33543389-33543411 CTGAACCAATCAGGGTGTCTGGG + Intergenic
1165801026 19:38550245-38550267 CAGAACCAGGGATTGTATTTAGG + Intronic
1166354894 19:42221119-42221141 CTGTACTGGGCTGTGTGTTTTGG + Intronic
1166740341 19:45110913-45110935 CAGAACCAGGCAGGCTATTTCGG - Intronic
925645722 2:6034729-6034751 CTGAGCCAGACACTGTATTTTGG + Intergenic
925982258 2:9186383-9186405 CTGACCCAGGAAGTGTTTTTTGG - Intergenic
926024411 2:9528658-9528680 CAGAACCAGGCAGTTTGTGGGGG + Intronic
926321924 2:11754442-11754464 CTGAACCCAGGAGGGTGTTTCGG + Intronic
926765890 2:16322441-16322463 GTGAATCAGGCAGTGTGTCGGGG + Intergenic
927388235 2:22561496-22561518 CTGCACCAGGCACTGTGGTACGG + Intergenic
927388492 2:22564579-22564601 ATGAATCTGGCAGTGTGTGTTGG + Intergenic
927571769 2:24166540-24166562 CTGAGCCAGGCAGTGTTTGAGGG + Intronic
927786347 2:25977822-25977844 CTGAACCAGGCGGTGCCTTGGGG + Intronic
929091449 2:38221653-38221675 CTGTACCAAGCAGTGGGTGTTGG - Intergenic
929597413 2:43185071-43185093 TAGATTCAGGCAGTGTGTTTAGG - Intergenic
930520236 2:52456768-52456790 CAGGACTAGGCAGTGTGTCTTGG - Intergenic
931228556 2:60354619-60354641 CTGAAGCAAAGAGTGTGTTTTGG - Intergenic
934104144 2:88680706-88680728 CTGAAGCAGGCAAGGTGTATAGG - Intergenic
934212169 2:89990454-89990476 CTGAACCTGGCTGTGCATTTGGG - Intergenic
935782365 2:106519435-106519457 CTGAACCAGGCCCTGTATTGAGG + Intergenic
935868363 2:107417194-107417216 CTGAGCCAAGCAGTGTTATTAGG + Intergenic
936698442 2:114980691-114980713 TTGAACCTGGGATTGTGTTTTGG - Intronic
938244074 2:129763888-129763910 CTGAAATAAGCAGGGTGTTTGGG - Intergenic
938688712 2:133766373-133766395 CTGAGCCAGACATTGTGTTAGGG + Intergenic
938823634 2:134982994-134983016 ATGATCAAGACAGTGTGTTTAGG + Intronic
938964900 2:136379748-136379770 CTGCTCCAGGGACTGTGTTTTGG + Intergenic
940825227 2:158404103-158404125 CTATACCAGGCACTGTGTTAAGG - Intronic
941534929 2:166710642-166710664 ATGATCCAGTCAGTGTATTTAGG + Intergenic
944386510 2:199170513-199170535 TGAAACCAGGCATTGTGTTTAGG - Intergenic
945440302 2:209870753-209870775 TTGAATCATCCAGTGTGTTTGGG + Intronic
946493038 2:220168441-220168463 TTGAATCAGGCAGGGTTTTTAGG - Intergenic
1170111491 20:12808708-12808730 CTGAACCCAGCAGTGTGGCTGGG + Intergenic
1171468167 20:25347361-25347383 CTGTACCAGGATGTGTGATTGGG + Intronic
1171780704 20:29415351-29415373 CAGGACCAGGCAGTGTGGCTGGG + Intergenic
1172771690 20:37385938-37385960 CTGAACCTGACTGTGTCTTTGGG + Intronic
1172885601 20:38228870-38228892 CTGAACCAGGGAGGGTGTTTTGG - Intronic
1173732830 20:45340500-45340522 CTGGCCCAGCCAGTGTGTTGTGG - Intronic
1174306642 20:49618152-49618174 GGGAACCAGGCTGTGTTTTTAGG - Intergenic
1176128809 20:63487693-63487715 CAGAACCAGGCTGCGGGTTTTGG - Intergenic
1178778433 21:35575386-35575408 CTGAACCAGGCTTTCTGTTGTGG - Intronic
1178892022 21:36528251-36528273 ATGTGCCAGGCAGTGTGGTTAGG + Intronic
1183327239 22:37200881-37200903 CTGGACTAGGAACTGTGTTTTGG + Intergenic
1184178445 22:42803280-42803302 CTGCATCAGGCAGTCTGGTTTGG - Intronic
1184611944 22:45609701-45609723 CTCAACCTGGCAGTGTTGTTTGG - Intergenic
950128470 3:10526043-10526065 GTGCACCAGGCACTGTGTTAAGG - Intronic
950175187 3:10868552-10868574 CTTAACCAAGGGGTGTGTTTTGG + Intronic
953040118 3:39248947-39248969 TTAAACCAGGCAGTGTCCTTGGG + Intergenic
953043805 3:39277915-39277937 ATGGGTCAGGCAGTGTGTTTGGG + Intronic
954644874 3:52125032-52125054 CAGAACCAAACAGGGTGTTTGGG - Intronic
954654117 3:52183554-52183576 CTTTAAAAGGCAGTGTGTTTAGG - Intergenic
955160571 3:56461690-56461712 ATGAACCAGGAAGGGTGTGTAGG + Intronic
955986328 3:64577309-64577331 CAAAAACAGGCAATGTGTTTGGG - Intronic
956445401 3:69321123-69321145 CTAAACCAGGCAGTGGGATTGGG - Intronic
956634765 3:71352939-71352961 CTAAACCTGGCAGTTTCTTTGGG - Intronic
957084303 3:75665921-75665943 CAGGACCAGGCAGTGTGGCTGGG - Exonic
957528647 3:81411536-81411558 CTGAATCAGGCAGTTTCTCTGGG - Intergenic
957619811 3:82581119-82581141 CTAAACCAGGCACTATGTTATGG - Intergenic
958077980 3:88709069-88709091 CTTAAGCAGGCATCGTGTTTGGG - Intergenic
960997947 3:123351876-123351898 CTGACCCAGGCAGTCGGTCTAGG + Intronic
961507440 3:127379384-127379406 CTGTACCAGGCTCTGGGTTTGGG - Intergenic
961620348 3:128219127-128219149 CTCATTCAGGCAGTGTGCTTTGG + Intronic
961722627 3:128906787-128906809 CTGGGGCAGGCAGTGGGTTTGGG + Intronic
963359164 3:144248594-144248616 CTGAACCAATAAATGTGTTTAGG - Intergenic
964726545 3:159819749-159819771 CTAGACCAGGCAGTGTATCTAGG + Intronic
965290032 3:166866201-166866223 GTGAACCAGGCAGAGTGGTGAGG - Intergenic
965334192 3:167416001-167416023 CTGAACCAATCTCTGTGTTTAGG + Intergenic
966649563 3:182284441-182284463 CTGAACAAGGTATTGTGGTTTGG - Intergenic
968964304 4:3761759-3761781 CTGGACCAGGCAGTGGGGATGGG + Intergenic
969211108 4:5687836-5687858 CTTTACCAGGCAGAGTGTCTGGG + Intronic
969760127 4:9175506-9175528 CTGGAGCAGGCCGTGGGTTTTGG - Exonic
974263319 4:59553249-59553271 GTGGCCCAGGCAGGGTGTTTGGG + Intergenic
974630526 4:64481642-64481664 CTGAGCACAGCAGTGTGTTTAGG - Intergenic
976817864 4:89171545-89171567 ATAAACCAGGCTGTTTGTTTTGG - Intergenic
976959984 4:90958519-90958541 CTGGAGCAGGCTGTGTGTTTTGG + Intronic
979402678 4:120268300-120268322 CTCAACCAGACACTATGTTTTGG - Intergenic
979607923 4:122658400-122658422 CTGAAAAAGGGAGTGTGTTGGGG + Intergenic
982071468 4:151699100-151699122 CTGAACCAGGCCGGGTGTGGTGG + Intronic
984426986 4:179599788-179599810 CTGAGGCAGGAAGAGTGTTTGGG - Intergenic
984628482 4:182035856-182035878 CTGAACTAAGCAGTGTGTGGTGG - Intergenic
984944529 4:184960786-184960808 ATGAACCAGGCGGGGTCTTTGGG - Intergenic
986185814 5:5436529-5436551 CTGAAGCAGGCGGTGCTTTTAGG + Intronic
987630163 5:20459817-20459839 CTGAATTAGGTAGTGTGTCTTGG - Intronic
988229764 5:28460352-28460374 GTGAAGTTGGCAGTGTGTTTGGG - Intergenic
988376185 5:30439081-30439103 GGGCACCAGGCAGTGTGTTGAGG + Intergenic
989812738 5:45696599-45696621 CTGAACTAGCGAGTGTGTGTTGG + Intergenic
990120562 5:52445872-52445894 CTGAAACAGGAGGTGTGTTCAGG + Intergenic
990646002 5:57845177-57845199 CTGAATCATGCAGTGAGTTGTGG - Intergenic
991403444 5:66277860-66277882 CAGGAGCAGGCAGTGAGTTTTGG + Intergenic
991452101 5:66762965-66762987 GTGTAGCAGGCATTGTGTTTAGG + Intronic
992196367 5:74343320-74343342 CAGATCCGGGCAGAGTGTTTTGG - Intergenic
992558130 5:77923269-77923291 CTGAACTAAGCAGTGAATTTGGG + Intergenic
993843271 5:92907509-92907531 CTGAAGAAGACAGTTTGTTTTGG + Intergenic
994176450 5:96717229-96717251 CTGAACCATGCATTCTGTGTTGG - Intronic
994358713 5:98825628-98825650 ATGAACCAGGCAGTATTTTGTGG - Intergenic
995607846 5:113877163-113877185 CTGATTCAGGCTGTGTGCTTAGG + Intergenic
998526172 5:142845252-142845274 CTGTACCAGGAACTGTGTCTAGG + Intronic
999697279 5:154198326-154198348 CTGTACCAAGCATTGTGTTTGGG - Intronic
1000149333 5:158484371-158484393 CTGAACCAGGAAGTGGCATTTGG - Intergenic
1002592346 5:180299389-180299411 TCGAACTAGGCAGTGTATTTGGG + Intergenic
1003273152 6:4624749-4624771 AGAAACCAGGCACTGTGTTTTGG + Intergenic
1003645905 6:7912592-7912614 CTGAACCAGGAAGAGTGATGTGG - Intronic
1005281408 6:24278690-24278712 CAGAACCAGCCAGTGTCTATTGG + Intronic
1006058396 6:31402539-31402561 CTGAGGCAGGCACCGTGTTTAGG + Intronic
1006070836 6:31497082-31497104 CTGAGGCAGGCACAGTGTTTAGG + Intronic
1006510754 6:34519915-34519937 CTGAACCAGCAAGACTGTTTAGG + Intronic
1007709036 6:43810055-43810077 CTGGATCAGGCACTGTGTTTAGG - Intergenic
1008776140 6:55040200-55040222 CTCAACCAGTCAGTGGGCTTTGG - Intergenic
1011248177 6:85341738-85341760 TTGAACTTGGCTGTGTGTTTAGG - Intergenic
1013588953 6:111604363-111604385 CTGGACCAGTCACTGTGTGTGGG - Intronic
1016322006 6:142856545-142856567 TTGATCCAGGCAGTGTGCCTGGG - Intronic
1016748817 6:147610630-147610652 CTGAAACAGTCAGTGTGTGCAGG - Intronic
1022394135 7:29970382-29970404 GTTAACCAGGCAGATTGTTTTGG - Intronic
1023014855 7:35956620-35956642 AGGAACCAGGCAGTGTCTTCTGG - Intergenic
1025628214 7:63243210-63243232 AGGAACCAGGCAGTGTCTTCTGG + Intergenic
1028570479 7:92280948-92280970 CTGAACCTGGCAGGGTCTTGAGG - Intronic
1033015543 7:137667469-137667491 CTGAAAAAGGCAAAGTGTTTGGG - Intronic
1033954793 7:146833503-146833525 CTGTGCCTGGCAGTGTTTTTAGG + Intronic
1036263748 8:7259253-7259275 CTGGAGCAGGCCGTGGGTTTTGG - Intergenic
1036265048 8:7266875-7266897 CTGGAGCAGGCCGTGGGTTTTGG - Intergenic
1036266349 8:7274497-7274519 CTGGAGCAGGCCGTGGGTTTTGG - Intergenic
1036267651 8:7282119-7282141 CTGGAGCAGGCCGTGGGTTTTGG - Intergenic
1036268954 8:7289741-7289763 CTGGAGCAGGCCGTGGGTTTTGG - Intergenic
1036270252 8:7297363-7297385 CTGGAGCAGGCCGTGGGTTTTGG - Intergenic
1036297633 8:7549690-7549712 CTGGAGCAGGCCGTGGGTTTTGG + Intergenic
1036298938 8:7557339-7557361 CTGGAGCAGGCCGTGGGTTTTGG + Intergenic
1036300243 8:7564989-7565011 CTGGAGCAGGCCGTGGGTTTTGG + Intergenic
1036301550 8:7572634-7572656 CTGGAGCAGGCCGTGGGTTTTGG + Intergenic
1036302848 8:7580283-7580305 CTGGAGCAGGCCGTGGGTTTTGG + Intergenic
1036315788 8:7717792-7717814 CTGGAGCAGGCCGTGGGTTTTGG - Intergenic
1036317097 8:7725440-7725462 CTGGAGCAGGCCGTGGGTTTTGG - Intergenic
1036318406 8:7733088-7733110 CTGGAGCAGGCCGTGGGTTTTGG - Intergenic
1036319715 8:7740735-7740757 CTGGAGCAGGCCGTGGGTTTTGG - Intergenic
1036321022 8:7748383-7748405 CTGGAGCAGGCCGTGGGTTTTGG - Intergenic
1036322330 8:7756031-7756053 CTGGAGCAGGCCGTGGGTTTTGG - Intergenic
1036323639 8:7763679-7763701 CTGGAGCAGGCCGTGGGTTTTGG - Intergenic
1036324938 8:7771327-7771349 CTGGAGCAGGCCGTGGGTTTTGG - Intergenic
1036351100 8:8012981-8013003 CTGGAGCAGGCCGTGGGTTTTGG + Intergenic
1036352403 8:8020627-8020649 CTGGAGCAGGCCGTGGGTTTTGG + Intergenic
1036846386 8:12173400-12173422 CTGGAGCAGGCCGTGGGTTTTGG + Intergenic
1036867749 8:12415719-12415741 CTGGAGCAGGCCGTGGGTTTTGG + Intergenic
1037216140 8:16454044-16454066 GAGAACCAGGCATTGTGTTAGGG + Intronic
1038771029 8:30480186-30480208 CTGAAGCACTCAGAGTGTTTAGG + Intronic
1041570143 8:59328616-59328638 CTAAAACATGGAGTGTGTTTGGG + Intergenic
1042419309 8:68566660-68566682 CTGAACCAGGCATTGGCTTCAGG + Intronic
1042615722 8:70647004-70647026 ATGTACCAGGCAGTGTCTTCAGG + Intronic
1042678617 8:71352876-71352898 CTGAAACAGAGTGTGTGTTTAGG - Intronic
1047859309 8:128947177-128947199 ATGAAACAGGCAGTCTATTTTGG + Intergenic
1050218458 9:3357791-3357813 CTGAACCAGTCAGTGTAGTTGGG - Intronic
1050606297 9:7304768-7304790 CTGAAAAAGGCAGTTTATTTTGG + Intergenic
1052028580 9:23602674-23602696 CTGCCCCAGGCAGTAAGTTTCGG - Intergenic
1058499759 9:105600596-105600618 ATCAAGCAGGCAGTGTATTTTGG + Intronic
1058723928 9:107784361-107784383 CTGAACCAGGCAGTGGGGTGGGG + Intergenic
1060258703 9:122055076-122055098 CTGAGCCAGGCAGTATGCTTGGG + Intronic
1061279073 9:129586720-129586742 CTGAACCTGGCAGTGGAGTTGGG + Intergenic
1185675451 X:1845518-1845540 CATGACCAGGCAGTGGGTTTTGG + Intergenic
1185753136 X:2630191-2630213 ATGAACCAGGAAGTGTGGTAAGG - Intergenic
1188022023 X:25169656-25169678 GTGTACCAGGCATTGTGCTTAGG - Intergenic
1190484643 X:50912346-50912368 GAGTGCCAGGCAGTGTGTTTGGG + Intronic
1190997686 X:55626807-55626829 CTGCATCTGGCAGTATGTTTTGG + Intergenic
1195353763 X:104018904-104018926 CTGGATCAGGCAGTGTGTATGGG + Intergenic
1196467581 X:115988825-115988847 CTGCTCCAAGCAGTGTGTTATGG + Intergenic
1199261486 X:145780177-145780199 CTGAACCAGGCAGTGCCATAGGG + Intergenic
1199710164 X:150463291-150463313 CAGAACCTGGGAATGTGTTTGGG + Intronic
1202053265 Y:20803198-20803220 ATGAGCCAGGCAGTGAGTTGTGG - Intergenic