ID: 1071853555

View in Genome Browser
Species Human (GRCh38)
Location 10:89600213-89600235
Sequence CTGTGTAAGCACCTCTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071853555_1071853558 30 Left 1071853555 10:89600213-89600235 CCAAGAAAGAGGTGCTTACACAG 0: 1
1: 1
2: 1
3: 7
4: 154
Right 1071853558 10:89600266-89600288 ACAAAAATGCTATACTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071853555 Original CRISPR CTGTGTAAGCACCTCTTTCT TGG (reversed) Intronic
901395170 1:8975861-8975883 CAGTGTAAGAATCTCTTCCTAGG - Intergenic
904201953 1:28825683-28825705 CTGTGTAAGAACCCACTTCTTGG - Intronic
905008472 1:34730193-34730215 CTGTGTATGCACATCTATTTGGG - Intronic
908890737 1:68844650-68844672 CTGTGTCAGCATCTGCTTCTGGG - Intergenic
909323546 1:74320361-74320383 CTGTGGAAGCACCAATTTCATGG + Intronic
910976283 1:92909559-92909581 CTGTGAAAGCCACTCTTTCTGGG - Intronic
911953948 1:104212301-104212323 CTGGGGAAGCAACTCTTTATGGG + Intergenic
1064632834 10:17334461-17334483 CACTGCAAGCTCCTCTTTCTGGG - Intronic
1065537846 10:26732014-26732036 GTGCGTATGCACTTCTTTCTGGG - Intronic
1067795806 10:49320803-49320825 CTGTGTCATCAACTCTTCCTGGG - Intronic
1067841264 10:49681183-49681205 CTGATTCAGCACCTCTGTCTAGG - Intronic
1069826486 10:71258002-71258024 CAGTGAAAGCACGTGTTTCTTGG - Intronic
1071012034 10:80950841-80950863 CAGTTTAAAAACCTCTTTCTAGG + Intergenic
1071853555 10:89600213-89600235 CTGTGTAAGCACCTCTTTCTTGG - Intronic
1072916197 10:99538691-99538713 CTCTGTCAGCACCTCTTCCCTGG + Intergenic
1075346864 10:121688720-121688742 CTGGGTAAGTACCTCTCTGTGGG + Intergenic
1076322163 10:129591263-129591285 CTGTGCAAGCAGTTCTTTCCAGG + Intronic
1078486357 11:11726756-11726778 ATGTGCAAGAACTTCTTTCTGGG - Intergenic
1079002323 11:16768331-16768353 CTGTGTAATCTCCTCTTCTTAGG - Intergenic
1080744779 11:35098994-35099016 CAGAGCAAGCACCTCTGTCTGGG - Intergenic
1080925712 11:36753954-36753976 CTGTGTGAGCACCTAGCTCTGGG - Intergenic
1082626202 11:55489533-55489555 CTGTGTCAGCACTTGCTTCTAGG - Intergenic
1089173787 11:116534210-116534232 CTGTGTTGGCATCTCTTTCTTGG - Intergenic
1091251729 11:134149620-134149642 CTGTGTAAGAAGCCTTTTCTGGG - Exonic
1093864354 12:24206947-24206969 CTGTGTCAGCTCCTATTTCTGGG + Intergenic
1095094239 12:38137102-38137124 CTTTTTAAACATCTCTTTCTAGG - Intergenic
1100799596 12:98217139-98217161 CACTGTAACCACCTCTTCCTGGG - Intergenic
1102465637 12:113129511-113129533 GTGTGTGTGCACCTGTTTCTGGG - Intronic
1104496180 12:129241577-129241599 CTGATTAAGCACCACTTCCTTGG + Intronic
1107150503 13:37105476-37105498 CTGGGCCACCACCTCTTTCTCGG + Exonic
1110658161 13:78025456-78025478 CTTTCTAAACACCTCCTTCTAGG - Intergenic
1113469513 13:110534427-110534449 CGGTGGCAGCACCTCTTTGTAGG - Intronic
1116105663 14:40501086-40501108 TTGTGCAAGCACCTCTATATAGG - Intergenic
1121122612 14:91385447-91385469 CTGTGTTAGCTCCTCCTCCTGGG - Intronic
1122194568 14:100075320-100075342 CTGTGTGAGCACCTCAGTGTGGG + Intronic
1122533030 14:102442359-102442381 CTGTGTAAGAACCTCTGGCCTGG + Intronic
1123704751 15:22943012-22943034 CTGTGTGAGCACCTGCTTCGAGG - Intronic
1126124095 15:45279675-45279697 ATGTGTATGGACATCTTTCTAGG + Intergenic
1126456240 15:48865210-48865232 CTGTGTCATCACCTCTTTGCGGG + Intronic
1127174745 15:56341537-56341559 CTGTGTCAGCTTCTGTTTCTAGG - Intronic
1127940364 15:63689080-63689102 CTTTGAAAGCAACTCTTTTTTGG - Intronic
1129262554 15:74376803-74376825 GTGTGTGAGAACATCTTTCTGGG + Intergenic
1132486861 16:197729-197751 CTGAGTGAGCAGCTCTTTCCTGG + Intronic
1133452201 16:5913104-5913126 TTGTGTTAGCCTCTCTTTCTTGG + Intergenic
1135938042 16:26797696-26797718 CTGTCTCAGCACCTGCTTCTTGG - Intergenic
1140028006 16:71309161-71309183 CTGTGTCAACTCCTCTTTCCCGG - Intergenic
1140551452 16:75870494-75870516 CACTGTAAGCATCTCTTTCGGGG - Intergenic
1140840838 16:78837668-78837690 CTTTGTCAGCCCCTCTTTCTTGG - Intronic
1140989499 16:80195074-80195096 TTGTGTAAGCACCTCCTAGTTGG - Intergenic
1141813806 16:86395562-86395584 CTGGGTAAGGATCTCTTTGTTGG - Intergenic
1144418709 17:15075629-15075651 TTTTGTAAGCACTTCTGTCTTGG - Intergenic
1146142879 17:30384120-30384142 CTGTAGAAGCAGCTCTTTCAAGG - Intronic
1149987577 17:61359216-61359238 CTCTGTAAGCAGCTCTTCTTTGG - Intronic
1156682500 18:39608086-39608108 CTGTGTAAGCAAATATTTATAGG - Intergenic
1160357813 18:78243503-78243525 CTGGGTGAGCACCTGGTTCTGGG - Intergenic
927763343 2:25781006-25781028 CACTGTAAGCTCCTCCTTCTGGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930998583 2:57753434-57753456 CTCTGTAAGCACCTCTTTCTGGG - Intergenic
931976246 2:67646957-67646979 CTGTGTAACCTCATTTTTCTTGG - Intergenic
932485995 2:72084728-72084750 CTGTGTGGGCACCTCTGTCCTGG - Intergenic
934740606 2:96719235-96719257 CTGTGTACATGCCTCTTTCTTGG + Intronic
937071160 2:119064723-119064745 TTGTGCAATCACCTCCTTCTGGG + Intergenic
938264387 2:129916080-129916102 CTTTTTAAGCAAGTCTTTCTTGG + Intergenic
938578923 2:132628569-132628591 CTATCTATGCACATCTTTCTGGG + Intronic
940156429 2:150661698-150661720 CTGTGAAACAACCACTTTCTAGG + Intergenic
940665808 2:156607984-156608006 CAGTGTCAGCCTCTCTTTCTAGG + Intronic
941212928 2:162665652-162665674 TTGTATAAGCAACTCATTCTTGG + Intronic
943810746 2:192186216-192186238 CTGTGTAAGCACTGTTTTCCAGG + Intronic
947276780 2:228401203-228401225 CTGTGTAAGCACCTATCTGCTGG - Intergenic
948538633 2:238668355-238668377 CTGTGTAACCACCTAATTGTGGG - Intergenic
1171046664 20:21814545-21814567 CCTTGTCAGCACCTCTTGCTGGG - Intergenic
1173485389 20:43437348-43437370 CTCTGTAAGGACCTCATTCATGG - Intergenic
1175769073 20:61611528-61611550 CTGTGTGAGCACCTCTTTGCTGG + Intronic
1176057536 20:63156520-63156542 CTGTGGCTGCACCTCTTTCCTGG + Intergenic
1179899258 21:44380533-44380555 GTGTGAAAGCACCACTTTCAGGG - Intronic
1180181628 21:46120832-46120854 CTGCCTAAGCACCCCTATCTTGG - Intronic
950585585 3:13890130-13890152 CTGGGTAAGCCCCTTGTTCTGGG + Intergenic
951039481 3:17973085-17973107 GTGTTTAAGCCCCTCTTTCAGGG + Intronic
951296457 3:20942064-20942086 ATGTGCAAACACCTTTTTCTTGG + Intergenic
953550428 3:43898305-43898327 TTGTGTTAGTATCTCTTTCTGGG - Intergenic
956039112 3:65127697-65127719 CAGTGAAATCACCTCTCTCTAGG - Intergenic
957866701 3:86034480-86034502 CTCTGTGAGCACCTTGTTCTTGG + Intronic
958896063 3:99830700-99830722 CTTTGAAAGCACCAGTTTCTGGG + Intronic
962326875 3:134441727-134441749 ATGAGTATGCACCTCTTGCTAGG - Intergenic
973690143 4:53419793-53419815 CTGTGAAAGCACCTATTTCAGGG + Intronic
973847714 4:54929834-54929856 CCATGCAAGCACTTCTTTCTAGG + Intergenic
976012095 4:80502625-80502647 CCATGTGAACACCTCTTTCTTGG + Intronic
977124786 4:93151205-93151227 CTGTGTCACCATCCCTTTCTTGG + Intronic
977559737 4:98520186-98520208 CTTTGGTGGCACCTCTTTCTTGG - Intronic
977831957 4:101605009-101605031 CTGTGTAACATCCTATTTCTGGG - Intronic
978405118 4:108371064-108371086 CCGTGTCATCCCCTCTTTCTAGG + Intergenic
979675208 4:123402097-123402119 CTGTGTCAGGTCCTCTTTCAAGG - Exonic
980174899 4:129332850-129332872 CTCTGTAAGCCTCTCTTTCTAGG - Intergenic
982724738 4:158894099-158894121 CTTTTTAAACTCCTCTTTCTGGG - Intronic
984024491 4:174526568-174526590 CTGGGTAAGCAGCCCTTTTTTGG + Intergenic
984809386 4:183781400-183781422 AAGTGGAAGCACCTATTTCTGGG + Intergenic
984972778 4:185205504-185205526 CTGTGTTGGCACCACTTTCCAGG + Intronic
986400851 5:7378397-7378419 GTGTGTAAGCTCCTCTTCCAAGG + Intergenic
990521625 5:56586918-56586940 CTGTGTGAGCACCTCCTGATTGG + Intronic
991581564 5:68160930-68160952 GTGTGTGAGCACTCCTTTCTGGG + Intergenic
997133270 5:131298550-131298572 CTGTGAATTCACCACTTTCTAGG + Intronic
997552324 5:134764237-134764259 CTTTGTAGGCACATCCTTCTGGG - Intronic
997655211 5:135549339-135549361 CTGTTTAATCAACTTTTTCTGGG + Intergenic
997848504 5:137309822-137309844 CTGTTTGAGCACCTCCTACTTGG - Intronic
997942227 5:138168548-138168570 CTGTCCAAGCATCTTTTTCTGGG + Intronic
998839721 5:146240228-146240250 CTCTGTCTTCACCTCTTTCTAGG + Intronic
1003950420 6:11110846-11110868 CTGAGTTAGCACCCCTTTGTGGG - Intronic
1003989175 6:11468984-11469006 TTGTTAAAGCACCTGTTTCTGGG + Intergenic
1005048886 6:21666016-21666038 TTGTGTAAGCGCCTTTATCTAGG + Intergenic
1005269584 6:24148857-24148879 CTGTGTAAGCAGCTCCTTTGTGG + Intronic
1006471359 6:34231009-34231031 TTTTGTAAGCACCTAATTCTTGG - Intergenic
1007206221 6:40153844-40153866 CTGTGTACTCAGCTCTTGCTTGG - Intergenic
1008653704 6:53589423-53589445 CTTTGTGGGCTCCTCTTTCTTGG - Intronic
1009858411 6:69293365-69293387 CTCTCTAAACACCTCTGTCTGGG + Intronic
1010284081 6:74055034-74055056 GTGTCTAAGCTCCTATTTCTGGG - Intergenic
1010382856 6:75244355-75244377 CTGTGGAAGAACTTCTTGCTTGG - Intronic
1010470241 6:76218395-76218417 CTGGGTAAGCTTCTCTTTCCTGG + Intergenic
1015844481 6:137505551-137505573 CTGTGGAAGCATTTCTTCCTTGG + Intergenic
1015879138 6:137853529-137853551 TTATGCAATCACCTCTTTCTGGG + Intergenic
1015917833 6:138235748-138235770 CTGAGAAAGCATTTCTTTCTGGG + Intronic
1017049212 6:150374822-150374844 CTGGGTGGGCACCTCTTACTTGG + Intronic
1017796388 6:157848636-157848658 CTCTGTAAGCACCTCTTAGGTGG + Intronic
1018146608 6:160896978-160897000 CTATAAAAGCATCTCTTTCTTGG - Intergenic
1019019755 6:168908375-168908397 CTGTGTGAGAACCTATTACTTGG - Intergenic
1019107588 6:169681707-169681729 TTGTGTAAGCAGCTCTTACCTGG - Intronic
1021399306 7:20191382-20191404 CTGTCCAAGCACCTATTGCTTGG - Intronic
1026882553 7:73916765-73916787 CTGTGTGAGCTCATCTTTCCTGG + Intergenic
1027868414 7:83675471-83675493 CTGTGTAAGAAAGTCTTCCTGGG + Intergenic
1028114420 7:86981640-86981662 CTCAGGAAGCACCTCCTTCTGGG + Intronic
1029618049 7:101672128-101672150 CTGTGTGCGCACCTCCCTCTGGG - Intergenic
1030042866 7:105467725-105467747 CTGAGTAAGCACCTCTCTCTGGG - Intronic
1030869927 7:114743028-114743050 CTGTGGAAGCGCCAGTTTCTGGG + Intergenic
1030977927 7:116150258-116150280 CTGTTTAAGCTCCTCTTCTTTGG + Intronic
1031125227 7:117765776-117765798 TTCTGTAGGCAGCTCTTTCTGGG - Intronic
1035389261 7:158494825-158494847 CTGTGTCAGCACCACTCACTTGG + Intronic
1036212758 8:6855443-6855465 CTCTGTATGCCCCTCTCTCTGGG + Intergenic
1038281509 8:26169474-26169496 CTGTGCAAGCAGCTCTGCCTTGG - Intergenic
1039140943 8:34387394-34387416 ATGTGTATGCATCTATTTCTGGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1043662267 8:82758470-82758492 CTGTGTAACCTCATTTTTCTTGG - Intergenic
1043780171 8:84323745-84323767 CTATGAAAGCAACTTTTTCTTGG + Intronic
1044691996 8:94890151-94890173 CTGTGTACCAACCACTTTCTGGG - Intronic
1045014157 8:97984559-97984581 CTGTTTAAAAACCTCCTTCTAGG - Intronic
1047554918 8:125918934-125918956 CTGTTTTAGAACCTCTGTCTGGG + Intergenic
1047567476 8:126061715-126061737 ATCTTTAAGCACCACTTTCTGGG + Intergenic
1048412049 8:134185252-134185274 TTATATGAGCACCTCTTTCTTGG - Intergenic
1055096635 9:72421175-72421197 ATGTGTAAGCACCTTGATCTTGG - Intergenic
1056535479 9:87524125-87524147 CTCTGTAAGAACCTCTATCGGGG - Intronic
1058572301 9:106359569-106359591 GTGTTTAAACACCTATTTCTTGG + Intergenic
1059084628 9:111286920-111286942 CAGTTTAAGCACCTTGTTCTAGG + Intergenic
1059280663 9:113130728-113130750 CTGAGAAAGCACCTATTTTTAGG - Intergenic
1060177819 9:121510416-121510438 CTGTCTCAACACCTCTTTTTAGG - Intergenic
1060363811 9:122988246-122988268 CTGTGTTAGATCCTCTTCCTAGG + Intronic
1060768533 9:126313157-126313179 CTCTGTAGGCAACTCTTTGTTGG - Intergenic
1062601433 9:137320235-137320257 CTGTGCCAGCCCCTCTGTCTGGG - Intronic
1186937938 X:14471862-14471884 CTGTGAAATCTACTCTTTCTTGG - Intergenic
1187298195 X:18023000-18023022 TTGTCTAAGCATCTCTTTCCAGG + Intergenic
1189275810 X:39785163-39785185 TTGTGTAATCACCTCACTCTTGG - Intergenic
1189705999 X:43759540-43759562 CTGTGTATGGACCTCATCCTTGG + Intergenic
1197871377 X:131065731-131065753 CTGGGTCAGCACCTCATCCTGGG - Intronic
1198393488 X:136200437-136200459 TTCTGTAAGGACTTCTTTCTTGG - Intronic
1198630887 X:138637221-138637243 CTGTGAAAACTCCTCTTTGTAGG + Intronic
1199972827 X:152873221-152873243 CTGTGTAAGCTGCACTTGCTGGG - Intergenic
1200125018 X:153809273-153809295 CTTTATAAGGACCACTTTCTTGG - Intronic