ID: 1071854259

View in Genome Browser
Species Human (GRCh38)
Location 10:89607362-89607384
Sequence TTATATGGGCATAATGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071854253_1071854259 30 Left 1071854253 10:89607309-89607331 CCTGTCAATGGAGCAGTCAGAAC 0: 2
1: 70
2: 149
3: 259
4: 389
Right 1071854259 10:89607362-89607384 TTATATGGGCATAATGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071854259 Original CRISPR TTATATGGGCATAATGTGGT GGG Intronic
No off target data available for this crispr