ID: 1071854833

View in Genome Browser
Species Human (GRCh38)
Location 10:89613677-89613699
Sequence GCAAATTCTGCAACCAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071854832_1071854833 20 Left 1071854832 10:89613634-89613656 CCAAGTTAACAAATGTCTTGTTT 0: 1
1: 0
2: 1
3: 30
4: 339
Right 1071854833 10:89613677-89613699 GCAAATTCTGCAACCAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071854833 Original CRISPR GCAAATTCTGCAACCAGTGT AGG Intronic
No off target data available for this crispr