ID: 1071855032

View in Genome Browser
Species Human (GRCh38)
Location 10:89615465-89615487
Sequence TGCCAAGAAAAACTTTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 414}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071855032_1071855033 -5 Left 1071855032 10:89615465-89615487 CCATTTCAAAGTTTTTCTTGGCA 0: 1
1: 0
2: 2
3: 38
4: 414
Right 1071855033 10:89615483-89615505 TGGCAACTCAACAGAACAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071855032 Original CRISPR TGCCAAGAAAAACTTTGAAA TGG (reversed) Intronic
904254520 1:29246299-29246321 TGACAACAAAAACCTGGAAAAGG - Intronic
905388715 1:37622670-37622692 TGCCAGGAATAAGGTTGAAAAGG + Intronic
906002611 1:42439879-42439901 AGCTAAGAAAAACTATGAAGAGG - Exonic
906127205 1:43434239-43434261 GGCCAAGAGAAACCATGAAAAGG - Intronic
907998654 1:59658456-59658478 TGCCAAGAAAAACTGTCAGCAGG + Intronic
908643730 1:66254303-66254325 TCCCAAGATGAACTTTGAGATGG - Intronic
909199527 1:72672490-72672512 TCCCAAGAAAAATTTAGAAATGG - Intergenic
909720113 1:78757459-78757481 TGACAAGAAAAACTTCTAGAAGG + Intergenic
909858143 1:80567041-80567063 AACCAAGGGAAACTTTGAAAAGG - Intergenic
910167437 1:84342287-84342309 TCCAAAGATAAATTTTGAAAAGG + Intronic
910235484 1:85031540-85031562 TGCTAATAAGAACTTTAAAAAGG + Intronic
911517938 1:98891114-98891136 TGCCTAAAAAATCTTTAAAAAGG + Exonic
911686778 1:100786592-100786614 TGGTAAGAAAAATCTTGAAAGGG + Intergenic
911768235 1:101705442-101705464 TGCCTTCAAAAAGTTTGAAAGGG + Intergenic
911845132 1:102743478-102743500 TGCCAAGAAATTGTTTGAAGTGG - Intergenic
914322754 1:146580989-146581011 TCCCATGAAGAACTTTGTAAAGG - Intergenic
914452355 1:147803619-147803641 AGAAAAGAAAAACTTTGAAATGG + Intergenic
915739864 1:158110884-158110906 TGTCAGGAAAGACTTTAAAATGG - Intergenic
916635617 1:166664891-166664913 TGTCAAGAAAAACTTCAAAGAGG + Intergenic
917812305 1:178671406-178671428 TGCCAACAAAATATTTGAATAGG + Intergenic
918419317 1:184347297-184347319 AGACATGAAAAACTTTGAATAGG + Intergenic
918513360 1:185335601-185335623 TTCCAAGTATAACTTAGAAAGGG - Intergenic
919466497 1:197926611-197926633 TGCTAAGAAAGTCTTTGTAAGGG + Intronic
919558350 1:199089755-199089777 TGCCAAGCAAGACGTTGAACAGG + Intergenic
920376084 1:205508838-205508860 TGTCAAAAAAAAAATTGAAAAGG + Intronic
920903955 1:210141829-210141851 TGCCCAGAAAAAACTTGAGAAGG - Intronic
921834047 1:219759703-219759725 TGCTAAGAATAACTTTTGAATGG + Intronic
923903334 1:238354444-238354466 TGGCAAGATAAATTTTAAAAAGG - Intergenic
923971782 1:239210952-239210974 TGCCAAGAATAACTTGGATAAGG - Intergenic
924171000 1:241340957-241340979 TGCCAGGGAAATCTCTGAAACGG + Intronic
924407516 1:243765970-243765992 GGCCAAGAAAAGCTTTGTAGAGG - Intronic
1063339661 10:5251403-5251425 TCACAAGGAAAACTTTGAAGAGG - Intergenic
1063718394 10:8553371-8553393 TGTCAAGAAAAAATATGAAATGG - Intergenic
1064683733 10:17837340-17837362 GGACAAGAAAAACTCTGACAGGG + Intronic
1065975292 10:30836398-30836420 AGTCAAGTAAAACTTTGAAAAGG + Intronic
1067853007 10:49767738-49767760 TGACAAAGAAACCTTTGAAAGGG + Intergenic
1067940759 10:50653651-50653673 TGCAGAGAAGAACCTTGAAAGGG + Intergenic
1068389629 10:56378123-56378145 AGCCAAGAATAACATTGAAAGGG - Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1069192892 10:65511947-65511969 TGGAAAGAAGAACTTTGTAAGGG + Intergenic
1069204570 10:65665615-65665637 TACTTAGAAAAACTTTAAAAAGG + Intergenic
1071593439 10:86898670-86898692 TGCAAAGAAAAACCAAGAAAGGG - Intronic
1071855032 10:89615465-89615487 TGCCAAGAAAAACTTTGAAATGG - Intronic
1072150697 10:92680475-92680497 GGCCAAAAAAAACTTTAAATGGG - Intergenic
1073346990 10:102791025-102791047 TGACAATAAAAACTCTGAAGTGG - Intronic
1074714439 10:116205274-116205296 TCCCAATAAAAATTTTAAAAGGG + Intronic
1074796203 10:116947328-116947350 TACCAACAAAATCTTTCAAAAGG + Intronic
1074932394 10:118142344-118142366 TATTAAGAAAAACATTGAAATGG - Intergenic
1075031358 10:119026751-119026773 TGCCAACACAAACTTGGAAAAGG + Intergenic
1075050176 10:119177762-119177784 TTCTAAGGAAAACCTTGAAATGG - Intronic
1075275932 10:121092462-121092484 TGCCAAGGGAATCTTTGAAATGG + Intergenic
1075801265 10:125155173-125155195 TTCTAAGAAAAACTCTGGAAAGG + Intronic
1079064791 11:17280091-17280113 TGCCAAAAAAAACTCTGCCAAGG - Intronic
1079240588 11:18719796-18719818 GCCCAAGAAAGACTTTGAGAAGG - Exonic
1079961819 11:26933612-26933634 AGGAAAGAAAAACTTAGAAAAGG + Intergenic
1080832955 11:35913499-35913521 TACCAAAAAAAAGTTTGCAATGG + Intergenic
1082797023 11:57385516-57385538 GGCCAAGAAAAATTTTTCAATGG + Intergenic
1083111419 11:60412128-60412150 TGCCAACAAAATATTAGAAAAGG - Intronic
1084021068 11:66418618-66418640 TGGGAAGAAACACTTTGGAAGGG - Intergenic
1085674174 11:78499606-78499628 CAACAAGAAAATCTTTGAAAAGG + Intronic
1086541157 11:87914691-87914713 AGCCTGGAAAATCTTTGAAATGG - Intergenic
1087957375 11:104305031-104305053 TCCCAAGAAAACCCTGGAAAAGG + Intergenic
1088059390 11:105627892-105627914 TATCAAGAATAACTTTAAAAAGG - Intronic
1088215947 11:107509652-107509674 TGCAAAGAAAAACCTCAAAATGG - Intronic
1088565962 11:111173374-111173396 TGGTAAGAAAGAATTTGAAAAGG + Intergenic
1089385415 11:118064289-118064311 TGCAAAGAAAAAATTTTAAATGG + Intergenic
1089422520 11:118342466-118342488 TGGCAAGAAACACTTTCAAGTGG + Intronic
1090330864 11:125931218-125931240 TGCAAAGAAAATCAGTGAAAGGG + Intergenic
1090368131 11:126225239-126225261 TGCCAAATAAAAAATTGAAAAGG - Intronic
1090500888 11:127259673-127259695 TGCTAAGAATAAATTTGATAAGG + Intergenic
1090919378 11:131194664-131194686 TGCCAAGAATGACTTGGCAAAGG + Intergenic
1091893114 12:4078053-4078075 TGCCAAAAAACATTTTAAAAAGG + Intergenic
1093109056 12:15127060-15127082 GGCCAAGAAAGACTTTAAAGAGG - Intronic
1093190082 12:16064375-16064397 TGCTAACAAAGACTTTGAAATGG + Intergenic
1095336118 12:41028387-41028409 TGCCATGATACATTTTGAAATGG + Intronic
1095440479 12:42234687-42234709 TGCCAATAAAGACTTTAAAGGGG + Intronic
1095987743 12:48010780-48010802 TGCCAAAAACAACCTTGAGAGGG + Intergenic
1096176572 12:49524815-49524837 TAACAAGAAAAACTTTGCACCGG + Exonic
1096931732 12:55217240-55217262 GGGCAAAAAAAACCTTGAAAAGG - Intergenic
1098110462 12:67116229-67116251 TGCCAAAAAAAACCTTGTAATGG - Intergenic
1098926353 12:76354290-76354312 TGCCAAGAAAACATGGGAAATGG + Exonic
1099337647 12:81384154-81384176 TGAAAAGCAAAACTATGAAATGG - Exonic
1099582244 12:84464920-84464942 GGAGAAGAAAAATTTTGAAAAGG - Intergenic
1100132159 12:91509109-91509131 TGTCAAGAAAAATTTTCAGAGGG + Intergenic
1102776874 12:115527371-115527393 TGCAAAGAAAATCTTGGACAGGG + Intergenic
1102824007 12:115931545-115931567 AGTCAAGACAAAATTTGAAAGGG - Intergenic
1103781871 12:123404112-123404134 TGCCCAGGGAAACTTTTAAAAGG + Intronic
1105753408 13:23443029-23443051 TGCAAAGAAGAACTTTCCAAAGG + Intergenic
1106767744 13:32932050-32932072 TGCCAAGAGAAAATTTGAGAAGG + Intergenic
1107030262 13:35843715-35843737 TGCCAAGATAAAATGTGAAGTGG - Intronic
1107038468 13:35924293-35924315 TGACAAGAAAGCCTTTGTAACGG - Intronic
1107116498 13:36752618-36752640 TGGGAAGAAAAATTTTGAATAGG + Intergenic
1107305884 13:39018658-39018680 TGCCAAAAAAAAATTTTTAATGG + Intronic
1107806573 13:44158983-44159005 TGCCAAGAACAACTTTGTTCCGG - Intronic
1107843502 13:44485554-44485576 TGCCTAGAATAACCTGGAAATGG + Intronic
1109163952 13:59010334-59010356 GGCCAAGAAAAAGGCTGAAAGGG + Intergenic
1109210765 13:59533212-59533234 TGGCAAGAAATACTTTTTAAAGG - Intergenic
1109239925 13:59873589-59873611 TGAAAATGAAAACTTTGAAAAGG - Intronic
1109247757 13:59977330-59977352 TGACAAGCAATACTTTGTAAGGG + Intronic
1110032597 13:70635430-70635452 TGAAAAGTAGAACTTTGAAAAGG + Intergenic
1111168451 13:84493293-84493315 AACCAAGAAAATCTTTTAAAAGG - Intergenic
1111187529 13:84758693-84758715 TGCAAAGCAAATGTTTGAAATGG - Intergenic
1111379032 13:87421592-87421614 TGCCAAGGAAGATTTTAAAAAGG - Intergenic
1111732395 13:92093135-92093157 AATTAAGAAAAACTTTGAAATGG - Intronic
1111753963 13:92368926-92368948 TGAGAAGAAAAACTGTGAAGTGG + Intronic
1113312940 13:109149882-109149904 TCCCAAGTAAAACTTTAAAGAGG - Intronic
1113516776 13:110909088-110909110 TGCCATAAGACACTTTGAAAAGG + Intronic
1113815476 13:113167068-113167090 TCCTAAAACAAACTTTGAAAAGG + Intronic
1114239905 14:20857195-20857217 TGCAAAGACAATCTCTGAAAAGG - Intergenic
1114325456 14:21584374-21584396 TGCAAAGAAAAACTTTTAAGGGG + Intergenic
1115204673 14:30889044-30889066 TGCCAATATAAAGATTGAAATGG + Intronic
1115314241 14:32009446-32009468 TGCTCAGAAAGAATTTGAAAGGG - Intronic
1115367730 14:32577444-32577466 TTCCAGGAAAAGCTTTGAAAAGG - Intronic
1115894680 14:38073113-38073135 TTCCAAGATAAAGTTAGAAAAGG + Intergenic
1115925794 14:38432320-38432342 TTAAAAGAAAAACTTTCAAAGGG - Intergenic
1116237861 14:42303801-42303823 TTCCATGTAAAACTTTGAACAGG + Intergenic
1118603562 14:67487221-67487243 ATCCAAGAAAAACATTGCAAGGG + Intronic
1120515865 14:85469298-85469320 TGTCTAGAAAAACTTTTAAAGGG + Intergenic
1120775209 14:88427159-88427181 TGCCAAGAATAATTTTAAATTGG + Intronic
1123671105 15:22658618-22658640 AATTAAGAAAAACTTTGAAATGG - Intergenic
1123967814 15:25476614-25476636 TGGGAAGAAAAACTAGGAAAAGG + Intergenic
1124527040 15:30464993-30465015 AATTAAGAAAAACTTTGAAATGG - Intergenic
1124771613 15:32542690-32542712 AATTAAGAAAAACTTTGAAATGG + Intergenic
1125020637 15:34982770-34982792 TGACAAAAACAACATTGAAAAGG + Exonic
1126378847 15:48025165-48025187 TTACAAGAAAAAGTGTGAAAAGG - Intergenic
1126960037 15:53982120-53982142 AGACAAGAAAATATTTGAAAGGG - Intergenic
1127472208 15:59300400-59300422 TGCCAATAAAGACTCAGAAATGG - Intronic
1128349698 15:66880725-66880747 TGGCTAGAAAAGCTTTTAAAAGG + Intergenic
1128807634 15:70543620-70543642 AGCCAACACAAACTTTAAAAAGG + Intergenic
1129077527 15:73009820-73009842 TGCCAAGAAAATATTGGATATGG + Intergenic
1131665120 15:94562557-94562579 TCCAAAGAAAAACACTGAAATGG + Intergenic
1132045330 15:98558587-98558609 GGCCAAAAATAATTTTGAAAAGG + Intergenic
1133341081 16:5036561-5036583 TGCTTAGAAAAACTTGGCAAAGG - Intronic
1133572274 16:7053141-7053163 TGCCAACAGCAACTGTGAAATGG - Intronic
1134798229 16:17060999-17061021 TGCCAAGAATAAATTTACAATGG - Intergenic
1135223318 16:20633717-20633739 TGCCAAAACAATCTTTAAAAAGG + Intronic
1135993770 16:27233186-27233208 TGGCAAAAATAACTTTTAAATGG + Intronic
1138665926 16:58568387-58568409 TGTAAAGAAAAACTTTGAGCCGG + Intronic
1138841403 16:60512355-60512377 AGCTAAGAAAAACTTTAAGAAGG - Intergenic
1138955822 16:61969360-61969382 TGCCAAGAAAGATTCAGAAAGGG - Intronic
1139265806 16:65637205-65637227 TGCTAAATAAAATTTTGAAATGG + Intergenic
1140010809 16:71129861-71129883 TCCCATGAAGAACTTTGTAAAGG + Intronic
1140060021 16:71560798-71560820 AACCAAAAAAAATTTTGAAAAGG - Intronic
1140646918 16:77041341-77041363 TGAAACGAAAAACTTTTAAAAGG - Intergenic
1143556913 17:7667806-7667828 TGCCAGGAAAACCTTTCAAAGGG - Intronic
1144408235 17:14973658-14973680 TCCCAAGATAGACTTTGACATGG - Intergenic
1144609189 17:16694279-16694301 TGGCAATAAGAACTGTGAAATGG + Intronic
1144903574 17:18621250-18621272 TGGCAATAAGAACTGTGAAATGG - Intergenic
1145195671 17:20892142-20892164 TGGCAATAAGAACTGTGAAATGG - Intronic
1146024864 17:29311186-29311208 AGGCAAGAAATACTTTGACAGGG - Intergenic
1146506623 17:33411306-33411328 TGATTAGAAAAACTTTGAGATGG + Intronic
1147469474 17:40646430-40646452 TGAGGAGAAAAATTTTGAAATGG - Intronic
1147758558 17:42783379-42783401 GGCCATGAGAAACTTTGAAGGGG - Intronic
1148941471 17:51216488-51216510 TGAAAAGAAAACCTTTTAAAGGG + Intronic
1149009162 17:51836924-51836946 TGCCAAGTAAAACCTTCCAATGG - Intronic
1149193623 17:54093020-54093042 CACCTGGAAAAACTTTGAAAGGG - Intergenic
1150629182 17:66866276-66866298 TGCCAAAAAAAATTTTAAAAAGG - Intronic
1150724027 17:67636969-67636991 TGCCCAGGAAAACTCAGAAAGGG - Intronic
1151065148 17:71140604-71140626 TTCAAAGAAGAACATTGAAAAGG + Intergenic
1152269565 17:79316112-79316134 TGCCAAGTAAAAATTGGAGAGGG + Intronic
1156437125 18:37144287-37144309 TACCAAGACAAACTAAGAAAAGG - Intronic
1156781441 18:40855424-40855446 TGCAGAGACAAACATTGAAAAGG - Intergenic
1157318179 18:46610883-46610905 TGAAAAGGACAACTTTGAAAAGG - Intronic
1157571851 18:48717725-48717747 TGCTAAAAAAAATTTTGAAGGGG - Intronic
1159301812 18:66582396-66582418 TGCATAAAAAGACTTTGAAATGG + Intronic
1160305516 18:77731548-77731570 ACCCAGGAAAAACATTGAAAAGG + Intergenic
1164487179 19:28668487-28668509 TGCCAAGGAAACCTTTGCATGGG + Intergenic
1164788109 19:30952686-30952708 TGCCAAGAAAAGCAATGCAAAGG - Intergenic
1166580591 19:43895207-43895229 TGCTAATAAACACTTTGAATTGG + Intronic
925690657 2:6519807-6519829 TGCCAACAAAAGCCTTGCAAGGG - Intergenic
926257140 2:11214921-11214943 TGCCAAGTTAAAACTTGAAAAGG - Exonic
926264582 2:11303651-11303673 TGTAAAGAAAAAGATTGAAATGG - Intronic
926472968 2:13284742-13284764 TAAAAAGAAACACTTTGAAAAGG - Intergenic
928752471 2:34486773-34486795 TTCAAACAAAAACTCTGAAAAGG + Intergenic
929918437 2:46155269-46155291 AGCCAAGGAAAACTTTGACCTGG + Intronic
929932624 2:46270753-46270775 TGCCAAGGATAACTTTCAAGGGG - Intergenic
931432801 2:62222314-62222336 AGCCAAGAAAAAAATGGAAAAGG + Exonic
931874300 2:66495636-66495658 TGCCATGCAAAACTGGGAAAGGG - Intronic
932047837 2:68367779-68367801 GGCCATAAAAATCTTTGAAAAGG + Intronic
932300567 2:70664029-70664051 TGCCTAGAAAAACTCTGAGCTGG - Intronic
932346167 2:70996627-70996649 GGCAAAGAAAAATTTTAAAATGG + Intergenic
933836956 2:86253507-86253529 TGCCAAGAATCACTTCCAAAGGG - Intronic
934706207 2:96483294-96483316 TGCCAACAAAAGCTGGGAAAGGG - Intergenic
935169697 2:100601458-100601480 CTCCAGGAAAAACTTTTAAATGG + Intergenic
935251238 2:101263328-101263350 TTATAAGAAAAACTTTAAAATGG - Intronic
935311764 2:101791069-101791091 GGAAAAGAAAAAGTTTGAAAAGG + Intronic
935423530 2:102895361-102895383 TGCTACTAAAAACTTTGGAATGG + Intergenic
935542094 2:104360825-104360847 TGCCAAGTTAAACTTTGTGAGGG + Intergenic
935714906 2:105931223-105931245 AGAAAAGAAAAACTGTGAAAGGG + Intergenic
936669682 2:114642739-114642761 TGTTAAGAAACACTCTGAAAGGG - Intronic
937180579 2:119992395-119992417 TGCCAAGTAAACATATGAAAGGG + Intergenic
937747168 2:125428166-125428188 TGCCAAGAAGACCTTTGACCTGG - Intergenic
938216478 2:129522159-129522181 TGCCAGGAAAAACACTGAGAAGG - Intergenic
939021130 2:136959838-136959860 TGTCAAGAAAAACTCTGGAGGGG + Intronic
939381089 2:141437231-141437253 TGCTAAGAAAAGCTTGTAAAAGG + Intronic
939394054 2:141605717-141605739 TGCCAAGAAAGACTTTGGAAAGG + Intronic
939713400 2:145552544-145552566 AGCCAAAATAAACTTTTAAATGG + Intergenic
941794700 2:169586247-169586269 TGCCTAGAAAAGCCTTAAAAAGG - Intronic
943249499 2:185499427-185499449 TCCCATTAAAAATTTTGAAATGG + Intergenic
943474289 2:188335371-188335393 TGCAAAGAAAACATCTGAAAGGG - Intronic
944366117 2:198921413-198921435 TCCCAATAAAAAATTTGAATTGG + Intergenic
944402992 2:199349879-199349901 TTAAAAGAATAACTTTGAAAGGG + Intronic
944415607 2:199476651-199476673 TTCTATGAAAGACTTTGAAATGG - Intergenic
945037976 2:205720665-205720687 GGCCAAGAGGAATTTTGAAAAGG - Intronic
945159508 2:206874801-206874823 TACCAAGAAAACCTTTGCAATGG + Intergenic
946725193 2:222655383-222655405 TGCCAAGAACAACTTTAGATAGG - Intronic
948072474 2:235138974-235138996 TGCGAGGACACACTTTGAAATGG - Intergenic
948578015 2:238966507-238966529 AGCCAAGAAATGCTTTTAAAGGG + Intergenic
1169805736 20:9557566-9557588 TGACAAGAAAAACTACGAACGGG + Intronic
1170269585 20:14509989-14510011 TGCCAATAAAGACTTTTAAAAGG - Intronic
1170985263 20:21252120-21252142 TGCACAGAAAAAGTGTGAAAGGG - Intergenic
1172580743 20:36045375-36045397 TGCCAAGTGAAACTGTGGAAAGG + Intergenic
1173141006 20:40482821-40482843 TGCCAGCAAACACTTTGATATGG - Intergenic
1173613395 20:44387361-44387383 AGGAAAGAAAAACTTTAAAATGG + Intronic
1174165784 20:48582674-48582696 TGACAAGAAAGACTTTGCATTGG - Intergenic
1174931761 20:54823883-54823905 TCCCAAAAAAATCTCTGAAAGGG + Intergenic
1175039960 20:56039618-56039640 TTCCATGATAAACTTGGAAATGG + Intergenic
1175555401 20:59850706-59850728 TGAGATTAAAAACTTTGAAAAGG - Intergenic
1175600955 20:60272626-60272648 TGACAAGAACAATTTGGAAAAGG - Intergenic
1175967586 20:62667208-62667230 TGCCAAGACATACTGTGAAGTGG + Intronic
1177099106 21:16877984-16878006 TGGTAAGAAAAACATTAAAAAGG - Intergenic
1177831149 21:26140485-26140507 TGCCAAGAAAATCCTACAAAAGG - Intronic
1177919932 21:27139809-27139831 TGTTAACAAGAACTTTGAAAAGG + Intergenic
1178261840 21:31106974-31106996 TGCCTAGTGAAACTGTGAAAAGG - Intergenic
1178953409 21:37004098-37004120 TGCAATGAAAAAGTTTGATAAGG - Intergenic
1179206087 21:39280465-39280487 TGGCCAGAAAAACTTTAACAAGG + Intronic
1180188864 21:46153360-46153382 TCACAAAAATAACTTTGAAAGGG + Intronic
1180646950 22:17347268-17347290 TCCCAAGAAGAACCTTGAGAAGG + Intergenic
1182256435 22:29042427-29042449 TGCCAAGGCCAACTTTGAAAAGG + Intronic
1183106372 22:35617908-35617930 TGTCAAGAAAAACTTTTCAGAGG - Intronic
1185355058 22:50363538-50363560 AGCCAAGAAACACAGTGAAAAGG - Intronic
951582284 3:24178594-24178616 GACAAAGAAAAACTGTGAAACGG + Intronic
952063637 3:29541308-29541330 TGGGAAGAAAAACTGTGAGATGG - Intronic
952122976 3:30266533-30266555 TGCCAAGAATGAGGTTGAAATGG - Intergenic
954747784 3:52796787-52796809 TGCCAAGAAGCAGTATGAAAAGG + Exonic
954939023 3:54353906-54353928 TGCCAGGAAGAACTTCTAAACGG - Intronic
954968490 3:54631883-54631905 GGCTAAGAAAAAATTTTAAAAGG - Intronic
955978491 3:64500778-64500800 AACCAAGATACACTTTGAAATGG + Intergenic
956228052 3:66981949-66981971 TGTCTAGAGAATCTTTGAAATGG - Intergenic
957188673 3:76977498-76977520 TGCAAAGAAAAGCTTTGTAATGG + Intronic
957784097 3:84858398-84858420 TGGCAAGAAAGACATTGAATTGG - Intergenic
958039111 3:88205233-88205255 TCCCAAGAAAACCTTGGACATGG + Intergenic
958736926 3:98020098-98020120 AGGGAAGAAAAAATTTGAAAAGG + Intronic
959499614 3:107090582-107090604 TGCCTAGAAATATTTTCAAAAGG + Intergenic
959858053 3:111184263-111184285 AGCAGAGAAAAACTTTAAAATGG - Intronic
960148020 3:114223859-114223881 TGCCAAGGAGGACTTTGATATGG + Intergenic
960828676 3:121820489-121820511 TGCTAATTAAAACTTTGAAGAGG - Intronic
961970684 3:130962964-130962986 TGCAAAGAAAAAGTTGGTAATGG + Intronic
962888993 3:139654751-139654773 TTCAAAGACAAACTTTAAAATGG + Intronic
963621706 3:147616022-147616044 TGAAAAGAAACATTTTGAAATGG + Intergenic
963640349 3:147854177-147854199 TGATAAAAAAAACTTGGAAATGG + Intergenic
963869521 3:150400027-150400049 AGCCAAAAATAACTTTGTAAGGG - Intergenic
964369563 3:155985543-155985565 GGCCAATAAAAACTTTGCACAGG - Intergenic
965334048 3:167413356-167413378 TGCCAAAAAAAAATTTGAAGAGG + Intergenic
965357009 3:167688030-167688052 AGCAAAGAAAAATTTTAAAATGG - Intronic
965386035 3:168047798-168047820 TGTCAATAAAAACTTTCACAAGG + Intronic
965693619 3:171383640-171383662 AGCCAAAAAAAAATTTGGAAAGG + Intronic
965816960 3:172646790-172646812 TGCCAGGAAAAACATTGTACTGG - Intronic
966340161 3:178916186-178916208 TCCAAATGAAAACTTTGAAATGG - Intergenic
966495199 3:180572493-180572515 TGCCAAGAGAAAAGCTGAAAAGG + Intergenic
966537209 3:181048053-181048075 AGCCAAGAAAGACTGAGAAACGG + Intergenic
966765729 3:183460281-183460303 TGCCAAGCAACCATTTGAAAGGG - Intergenic
966808918 3:183826505-183826527 TTCCAAGTACAACCTTGAAATGG - Intergenic
967372021 3:188757316-188757338 TGAAAAGATAAGCTTTGAAATGG - Intronic
967590723 3:191270903-191270925 TCCCAAAAAAAACTGTCAAAGGG + Intronic
968710910 4:2116769-2116791 GGCCAAGAACAACTTTGGAAGGG - Intronic
968786953 4:2629506-2629528 TGCCAAGTAAAATCTTGCAATGG - Intronic
969042613 4:4312401-4312423 TGCGAAGAATAACACTGAAACGG - Intronic
969985777 4:11209131-11209153 TCACAAGAAAAACTTTGACCAGG + Intergenic
970888187 4:21010702-21010724 TGCTAAAAATAAGTTTGAAAAGG - Intronic
971627308 4:28938411-28938433 TGCTAAAAAAAACTTATAAAAGG + Intergenic
971783857 4:31075002-31075024 TGCTGAAAAAGACTTTGAAAGGG + Intronic
971856343 4:32049076-32049098 TGACAATAAACACATTGAAAAGG - Intergenic
972089929 4:35268800-35268822 TGGCAAGAAAGACTTTGAATAGG - Intergenic
972835010 4:42859952-42859974 TAACAAAAATAACTTTGAAAAGG - Intergenic
973611202 4:52637339-52637361 TGCCGAGAAAGAGTTGGAAATGG - Intronic
974059997 4:57023981-57024003 TACAAAGAAAAATTTTAAAAGGG - Intronic
974254953 4:59439740-59439762 TGACAACAAAAAATTTGATAAGG - Intergenic
974563064 4:63546945-63546967 TGACAAGAAAAATTTTAAAATGG + Intergenic
974816335 4:67009110-67009132 TGACAAGGAAGACTTTGAAAAGG - Intergenic
974845339 4:67345072-67345094 TGCTAATCTAAACTTTGAAAGGG + Intergenic
974862303 4:67537490-67537512 TGTAAAGAAAAATTTTAAAATGG + Intronic
975103346 4:70539775-70539797 TGGCCAGAAAAACTTTGACAAGG + Intergenic
975802093 4:78070788-78070810 TCCCAGGAAGAACTTTCAAAAGG - Intronic
976136954 4:81947982-81948004 TGCCAATAAAACCTTTCGAATGG - Intronic
976358718 4:84151844-84151866 TGCTGAGAAAAACTTGGCAAGGG - Intergenic
976382392 4:84414700-84414722 AGCAAAGAAAATATTTGAAAGGG + Intergenic
976512152 4:85923476-85923498 TGGAAAGAAAAATTTTAAAAAGG - Intronic
976524345 4:86070213-86070235 TGGGAAGAAAAATCTTGAAATGG - Intronic
977008378 4:91602441-91602463 TGCCAAGAAAGTTTTTGAGAGGG - Intergenic
977297606 4:95228248-95228270 TGGAAAGAAAAAATTTGAAAAGG - Intronic
977787425 4:101053842-101053864 TGTTAAGAAAAACATTTAAAAGG - Intronic
978191445 4:105917351-105917373 TACCAGGAAAAACTTTCAAGAGG - Intronic
978521614 4:109621518-109621540 TGCCAAATGACACTTTGAAATGG + Intronic
978592049 4:110334796-110334818 TACCCAGGAAAACTCTGAAAAGG + Intergenic
978823767 4:112995661-112995683 TGCCAAGAACAATTTCCAAAAGG + Intronic
979409307 4:120355947-120355969 TGCCAATAAAGATTTTTAAAAGG + Intergenic
979759474 4:124383315-124383337 TGCAAAGAAAAAGTTTTTAAAGG - Intergenic
979875983 4:125891842-125891864 TTCCAAGAAAAACTTTCGGAGGG + Intergenic
980436049 4:132775263-132775285 GGCCAAGAAACAGTTTGATAAGG - Intergenic
981101702 4:140836145-140836167 TGTGAAGAAAAACATTTAAAAGG - Intergenic
981765075 4:148239817-148239839 TGTCCACAAAAACTTCGAAAAGG - Intronic
982468958 4:155762947-155762969 CAACAAAAAAAACTTTGAAATGG - Intronic
982672034 4:158332665-158332687 AGCCAAAAAAAATTTTAAAATGG - Intronic
983416507 4:167462426-167462448 GGCCAAGAAAAAGTTTTGAAAGG + Intergenic
983617326 4:169722383-169722405 TGGCTCAAAAAACTTTGAAAGGG - Intronic
983925702 4:173399565-173399587 TGGCTAGGAAAACTGTGAAAGGG - Intronic
984809757 4:183784761-183784783 TACCAAGAAAAAAGTGGAAATGG - Intergenic
985285499 4:188332700-188332722 TCTCAAAATAAACTTTGAAAAGG + Intergenic
987646599 5:20680412-20680434 TGCTATAAAAAATTTTGAAAAGG - Intergenic
988248755 5:28726163-28726185 TGCTAATAACAACTGTGAAAGGG + Intergenic
988382246 5:30512805-30512827 TGACAAGAAAAACTTGGAAAAGG + Intergenic
989176509 5:38532723-38532745 CACCAAGCAAAACTTTCAAATGG + Intronic
989373119 5:40730796-40730818 TGCTCAGAAAAACTTAGAAATGG + Intronic
990181893 5:53170284-53170306 AGCCAAAAAAGACGTTGAAATGG - Intergenic
990414028 5:55568948-55568970 TGCCAAGAAAACTTCTGCAATGG + Intergenic
990730712 5:58806016-58806038 AGCCAAGAGAAATTTTGTAAGGG + Intronic
990978314 5:61578454-61578476 TGACAAGGCAAACTTTGAAAAGG - Intergenic
991014801 5:61919613-61919635 TCCTAAGAAATACCTTGAAAAGG - Intergenic
992337652 5:75789403-75789425 TGCCATGAAGACCTTTGACATGG - Intergenic
992534462 5:77685003-77685025 GGCCAAGAAAATCTTAAAAATGG - Intergenic
992666474 5:79014338-79014360 TTCAAAGGAAAACTGTGAAATGG + Intronic
993325950 5:86536718-86536740 TGCAAAGAAGCAGTTTGAAAGGG + Intergenic
993910650 5:93678858-93678880 TTCAAAGAAACACTTTGAGATGG + Intronic
994133452 5:96258534-96258556 TCTAAAGAAAAATTTTGAAAGGG - Intergenic
994269355 5:97758833-97758855 TGGCAGGATAAATTTTGAAAAGG - Intergenic
994645200 5:102460006-102460028 TGCCAAGAAAAAGAAGGAAAAGG - Intronic
994689020 5:102993370-102993392 GGCCAAGAAACACTTTGAGTGGG - Intronic
996177041 5:120371479-120371501 CATCAAGAAAAACTTTAAAATGG - Intergenic
996999622 5:129744052-129744074 AGCTAAGAAAAACTCTGAAAGGG + Intergenic
997075935 5:130677045-130677067 TACCAAGAAAAAATGTTAAAAGG - Intergenic
997106244 5:131022198-131022220 TGCCAAGAAAAGCAAAGAAATGG + Intergenic
997390289 5:133509524-133509546 TCCCAAGAAAACCTTTTAAGGGG + Intronic
997476219 5:134144084-134144106 TGCCATGAAAAATGTTGAAGTGG - Intronic
998260606 5:140628738-140628760 TGCCAAGAAAAGCCATAAAATGG - Intergenic
998740263 5:145192750-145192772 TGCCAAGGAATAATTTGTAAGGG + Intergenic
998769451 5:145525275-145525297 TGCAAGGAGAAACTTTGCAAAGG - Intronic
998949978 5:147383762-147383784 AGCCAAGGAAATCTTTTAAAAGG - Intronic
999018958 5:148142052-148142074 ATCCAAGAAAAACTTTTACATGG - Intergenic
999074900 5:148785651-148785673 TACCAACAAAATCTTTGAAAGGG + Intergenic
999653580 5:153791447-153791469 TGCAAAGTAAAAGTTTAAAAAGG + Intronic
999857124 5:155606944-155606966 AGCCAAGAAAAAATTTCCAAAGG + Intergenic
1000959899 5:167587411-167587433 TGCCAAGAATAGTATTGAAATGG + Intronic
1004213763 6:13681725-13681747 TGCCATCGAAAACTTTGAAGAGG - Intronic
1005266170 6:24114333-24114355 GGCTAGGCAAAACTTTGAAAAGG - Intergenic
1006790418 6:36697700-36697722 TGCCAGGCAAAATTGTGAAAGGG + Intergenic
1008836624 6:55839800-55839822 TGGCAAAAAAAAGTCTGAAAAGG - Intronic
1009553367 6:65129240-65129262 TGCCAAGACCAATATTGAAAAGG - Intronic
1010023615 6:71190078-71190100 TCAAAAGAAAAACTTTGTAAAGG - Intergenic
1011088391 6:83568745-83568767 TATCAATAAAAACTTTAAAAAGG + Intronic
1011599751 6:89048979-89049001 TGCAAATAAAATGTTTGAAATGG + Intergenic
1011733274 6:90288058-90288080 TCCCAAGAAAATGTATGAAAAGG + Intronic
1012626909 6:101415886-101415908 TTCCAAGGAATACTTTTAAAGGG - Intronic
1012902745 6:105026131-105026153 TGCAAAAAGAAACTTTAAAATGG + Intronic
1013494468 6:110684569-110684591 TGTTAAGAAAAACTGTGGAATGG - Intronic
1014750970 6:125255698-125255720 GGCCTAGAAAAACTTTATAAAGG - Intronic
1014900496 6:126957942-126957964 TGCCAAAACAAGCTTGGAAAGGG + Intergenic
1015447361 6:133322141-133322163 TGCTGAGAAAAAATTTAAAAGGG + Intronic
1015502366 6:133947698-133947720 TGGCAAGGTAAACTTTGGAAAGG + Intergenic
1015575100 6:134662899-134662921 TGCAATGTAAAACTTAGAAAAGG + Intergenic
1015821098 6:137260996-137261018 TGGCAAAAAAAACTTCTAAATGG + Intergenic
1016216632 6:141611844-141611866 TTCTAAGAAATACTTTCAAAAGG + Intergenic
1017432954 6:154389031-154389053 TGAAAAGAAAACCTATGAAATGG - Exonic
1017476649 6:154800924-154800946 TGACAGAAGAAACTTTGAAAGGG + Intronic
1017784451 6:157743687-157743709 TGCTGAGAAACACTTTGGAATGG - Intronic
1019671508 7:2282325-2282347 TGCAAAGATAAACTGTGAGAGGG + Intronic
1019781060 7:2939966-2939988 TGGCAAGAAACACTCAGAAAAGG + Intronic
1020509313 7:9032995-9033017 TGCCAAGAAAAACTCGGTCATGG - Intergenic
1020606820 7:10348690-10348712 TGTTATGAAAAACTTTAAAAAGG + Intergenic
1021318625 7:19182922-19182944 TGAAAAGAAAATCTGTGAAATGG + Intergenic
1022985398 7:35649415-35649437 TGTCAACAAAAAGTGTGAAACGG + Intronic
1023125866 7:36953531-36953553 TGCTTAGAAAAACCTTTAAAAGG - Intronic
1024033644 7:45487063-45487085 TGCCATGACTATCTTTGAAATGG - Intergenic
1024103476 7:46057831-46057853 TTCTAAGAAAAATTTAGAAAAGG - Intergenic
1024186826 7:46957881-46957903 TGCTAAGAAAGATTTAGAAATGG + Intergenic
1024642877 7:51345462-51345484 GGCTAAGAAAGACTTTAAAAGGG - Intergenic
1026208917 7:68285205-68285227 TGCCAATGAAAAATTTGAAGAGG + Intergenic
1026297782 7:69070381-69070403 GGCCAAGAAACACTTTGGGAAGG + Intergenic
1026394230 7:69935403-69935425 TTCCTAAAAAAATTTTGAAAAGG - Intronic
1026397125 7:69966795-69966817 TTCCAAGAAAAAGTGTGAAATGG - Intronic
1026645574 7:72165205-72165227 TGCCTTGAAGAAATTTGAAACGG - Intronic
1027603497 7:80269859-80269881 TGTCAAGAAACACTGTGAACAGG + Intergenic
1028660183 7:93262597-93262619 TCCCAAGAAATTCTTTGTAATGG + Intronic
1028977965 7:96935007-96935029 TTTCCAGAATAACTTTGAAAGGG - Intergenic
1029852637 7:103480477-103480499 TGAAAAGAAGTACTTTGAAAGGG + Intronic
1030446963 7:109657912-109657934 TGACAAGAAGAACTAAGAAAAGG + Intergenic
1030930362 7:115516193-115516215 TAACAAGAAAAACTTTAAAAGGG + Intergenic
1031599336 7:123687050-123687072 TACGAAGAAAAAGTTTGAGAGGG - Intronic
1032500889 7:132398845-132398867 TGCCAAGTGTCACTTTGAAAGGG + Intronic
1032573385 7:133025945-133025967 TGCCAATGAAATATTTGAAAGGG - Intronic
1034827516 7:154279744-154279766 TGCCAAGACATTCTTTAAAAAGG - Intronic
1035229480 7:157455536-157455558 AGCCAAGACAATCTTGGAAAAGG - Intergenic
1035816378 8:2545558-2545580 TGCCTAGAAAAACCTGAAAATGG + Intergenic
1036393768 8:8349002-8349024 TGCCCAGCAAAACTTGCAAAAGG + Intronic
1037124288 8:15326694-15326716 TGTCAAGAACAGCTTTGAACAGG + Intergenic
1037190109 8:16114307-16114329 AGCTAAGAATAACTTTTAAATGG + Intronic
1038057022 8:23869312-23869334 TGCCAACATAAACTCAGAAAAGG - Intergenic
1040721151 8:50324653-50324675 TGCCAAAAAATATTTTCAAAAGG - Intronic
1041183714 8:55275714-55275736 AGCCAAGAAAAAATTTCCAAAGG + Intronic
1041784447 8:61616162-61616184 TGCAAAGAAAATCATTGCAACGG - Intronic
1041913668 8:63117302-63117324 TTCCAATAAAAACCTTAAAAAGG - Intergenic
1042231820 8:66564224-66564246 TACAAAGAAACACATTGAAAAGG - Exonic
1043444137 8:80302726-80302748 TGTCAAAAAAAAGTTAGAAAGGG - Intergenic
1043550356 8:81364629-81364651 AGCCAAGAAAAACTCAGATAGGG + Intergenic
1043835607 8:85042370-85042392 TGTCAAGAAAAGATTTAAAAAGG + Intergenic
1044913702 8:97089640-97089662 TACCAAGCAAAACTTTCAGAAGG - Intronic
1045073148 8:98532079-98532101 TGCAAAGAAAAACTTCTTAAAGG - Intronic
1045073672 8:98539120-98539142 TGCCAAGAAATAATTGGCAAGGG - Intronic
1045760254 8:105597588-105597610 TGCAAAGAAAAAGTTGAAAATGG - Intronic
1045997896 8:108384747-108384769 TGCAAAGCAAAACTTTCAATGGG - Intronic
1046420624 8:113979326-113979348 TCCCAAGACAGACTTTGACATGG - Intergenic
1046992919 8:120480476-120480498 TGGCCAGAACAATTTTGAAAAGG + Intronic
1047386738 8:124416785-124416807 TCTCAAAAAAAACTTTAAAAAGG + Intergenic
1048074924 8:131059338-131059360 AACCATTAAAAACTTTGAAAAGG + Intergenic
1048230455 8:132635529-132635551 TGGGAAGAAAAACCTTGAAAAGG + Intronic
1048432884 8:134386761-134386783 TGCTAACAAAATCATTGAAAGGG - Intergenic
1048930101 8:139308116-139308138 TGCCATGAAAGACTTGGAAATGG - Intergenic
1050410345 9:5357518-5357540 TGCAAAGAAAAGCTATAAAAGGG - Intergenic
1050709101 9:8439833-8439855 TGCCAGACAAAACATTGAAAAGG - Intronic
1050715686 9:8522504-8522526 TGACAACAAAATCTTTTAAAAGG + Intronic
1051282226 9:15453842-15453864 TTCCACAAAAAACTTTTAAATGG - Intronic
1051803632 9:20965566-20965588 TGCCACAGAAAACTTTCAAATGG - Intronic
1051955627 9:22689871-22689893 TTTCAATAAACACTTTGAAAAGG + Intergenic
1052758073 9:32561925-32561947 AACAAAGAAAAACATTGAAATGG - Intronic
1053184136 9:36000871-36000893 TGCCAAGAAAAAGGGGGAAAAGG + Intergenic
1053251838 9:36580687-36580709 GGCCAACAAAAACATGGAAAAGG - Intronic
1055033979 9:71798287-71798309 TGCCAATTAAAACATTTAAAAGG - Intronic
1055035483 9:71813926-71813948 TTCTTGGAAAAACTTTGAAATGG - Intronic
1055360263 9:75482311-75482333 TTCCTTGAAAAACTATGAAAAGG - Intergenic
1056149421 9:83770136-83770158 TGCCAAGACAAGCCATGAAATGG - Intronic
1057296765 9:93850015-93850037 TGGGAAAAAAAACTTTGCAAAGG - Intergenic
1057375272 9:94515762-94515784 TGCCAAAAAAAATCTTGTAAAGG - Intergenic
1057387821 9:94620067-94620089 TGGCAATAAAAAGTTAGAAATGG + Intronic
1057984308 9:99695222-99695244 AGCCAAAAAAAATCTTGAAAAGG + Intergenic
1058550088 9:106105591-106105613 AGGCAAGAAAAACAGTGAAAAGG - Intergenic
1186339144 X:8624312-8624334 AGCCAAGAAATACTTTCTAAAGG + Intronic
1186551949 X:10515724-10515746 GGCCAAGAACAACTGGGAAAGGG - Intronic
1186869296 X:13754280-13754302 TTCCTAGAAATACATTGAAATGG - Intronic
1187078431 X:15960096-15960118 TGGCAAGAAAACCATAGAAATGG - Intergenic
1187921254 X:24204216-24204238 TGCAAAGAAAAGCTTGAAAATGG - Intronic
1188406310 X:29814649-29814671 TGCCAAGGCCAACGTTGAAAAGG + Intronic
1188754041 X:33937954-33937976 TGCCAAGAAAATCTATTAATTGG - Intergenic
1188946215 X:36306037-36306059 TTGCCAGAAAAACTTTGAAAAGG - Intronic
1189918086 X:45876815-45876837 TGCTAAAAAAAACTTTACAATGG + Intergenic
1190379418 X:49825463-49825485 TGACAAGCACAACTATGAAATGG + Intergenic
1193411316 X:81166794-81166816 TGCAAAGAAGAACTTTAGAAAGG + Intronic
1195255704 X:103087832-103087854 TGACAAAAACAACATTGAAAAGG - Intronic
1195303351 X:103554492-103554514 TCCCAATAACAAATTTGAAAAGG + Intergenic
1195415194 X:104611953-104611975 GGCCAAGAAACATTTTAAAATGG - Intronic
1196068636 X:111494504-111494526 TGCCAAGAAAAAATATTTAAAGG + Intergenic
1196462141 X:115942535-115942557 GGCCAAGAAGAACTCTGCAAAGG + Intergenic
1196593821 X:117520172-117520194 TGCCATGGAACACTGTGAAAAGG - Intergenic
1196671833 X:118376542-118376564 TACCAAAAAAAAATTAGAAATGG + Intronic
1197115468 X:122827518-122827540 TTCCAATTAAAATTTTGAAAAGG + Intergenic
1198391684 X:136181540-136181562 TGCCTAGAAAAACCTTAAAATGG + Intronic