ID: 1071856104

View in Genome Browser
Species Human (GRCh38)
Location 10:89626047-89626069
Sequence CTGTAGGCATGAAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071856104_1071856114 21 Left 1071856104 10:89626047-89626069 CCTTCTCCCCTTCATGCCTACAG No data
Right 1071856114 10:89626091-89626113 CAGGGGTTAAGGAGAGGAAATGG No data
1071856104_1071856115 25 Left 1071856104 10:89626047-89626069 CCTTCTCCCCTTCATGCCTACAG No data
Right 1071856115 10:89626095-89626117 GGTTAAGGAGAGGAAATGGTAGG No data
1071856104_1071856111 4 Left 1071856104 10:89626047-89626069 CCTTCTCCCCTTCATGCCTACAG No data
Right 1071856111 10:89626074-89626096 GCTGTGTATTTCTGCTTCAGGGG No data
1071856104_1071856112 10 Left 1071856104 10:89626047-89626069 CCTTCTCCCCTTCATGCCTACAG No data
Right 1071856112 10:89626080-89626102 TATTTCTGCTTCAGGGGTTAAGG No data
1071856104_1071856113 15 Left 1071856104 10:89626047-89626069 CCTTCTCCCCTTCATGCCTACAG No data
Right 1071856113 10:89626085-89626107 CTGCTTCAGGGGTTAAGGAGAGG No data
1071856104_1071856109 2 Left 1071856104 10:89626047-89626069 CCTTCTCCCCTTCATGCCTACAG No data
Right 1071856109 10:89626072-89626094 AAGCTGTGTATTTCTGCTTCAGG No data
1071856104_1071856110 3 Left 1071856104 10:89626047-89626069 CCTTCTCCCCTTCATGCCTACAG No data
Right 1071856110 10:89626073-89626095 AGCTGTGTATTTCTGCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071856104 Original CRISPR CTGTAGGCATGAAGGGGAGA AGG (reversed) Intronic
No off target data available for this crispr