ID: 1071857983

View in Genome Browser
Species Human (GRCh38)
Location 10:89645090-89645112
Sequence GCGCGCCGGCCCCACGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 209}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071857973_1071857983 -4 Left 1071857973 10:89645071-89645093 CCTCTGCGCCCTGCCCCCCGCGC 0: 1
1: 0
2: 12
3: 159
4: 1094
Right 1071857983 10:89645090-89645112 GCGCGCCGGCCCCACGGCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 209
1071857971_1071857983 2 Left 1071857971 10:89645065-89645087 CCACCTCCTCTGCGCCCTGCCCC 0: 1
1: 1
2: 22
3: 200
4: 1809
Right 1071857983 10:89645090-89645112 GCGCGCCGGCCCCACGGCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 209
1071857966_1071857983 15 Left 1071857966 10:89645052-89645074 CCTGCCGACTCCCCCACCTCCTC 0: 1
1: 0
2: 8
3: 101
4: 974
Right 1071857983 10:89645090-89645112 GCGCGCCGGCCCCACGGCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 209
1071857969_1071857983 4 Left 1071857969 10:89645063-89645085 CCCCACCTCCTCTGCGCCCTGCC 0: 1
1: 1
2: 6
3: 74
4: 868
Right 1071857983 10:89645090-89645112 GCGCGCCGGCCCCACGGCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 209
1071857972_1071857983 -1 Left 1071857972 10:89645068-89645090 CCTCCTCTGCGCCCTGCCCCCCG 0: 1
1: 0
2: 6
3: 103
4: 830
Right 1071857983 10:89645090-89645112 GCGCGCCGGCCCCACGGCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 209
1071857970_1071857983 3 Left 1071857970 10:89645064-89645086 CCCACCTCCTCTGCGCCCTGCCC 0: 1
1: 0
2: 6
3: 79
4: 795
Right 1071857983 10:89645090-89645112 GCGCGCCGGCCCCACGGCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 209
1071857963_1071857983 22 Left 1071857963 10:89645045-89645067 CCCTCCTCCTGCCGACTCCCCCA 0: 1
1: 0
2: 5
3: 69
4: 738
Right 1071857983 10:89645090-89645112 GCGCGCCGGCCCCACGGCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 209
1071857968_1071857983 5 Left 1071857968 10:89645062-89645084 CCCCCACCTCCTCTGCGCCCTGC 0: 1
1: 1
2: 9
3: 95
4: 1068
Right 1071857983 10:89645090-89645112 GCGCGCCGGCCCCACGGCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 209
1071857967_1071857983 11 Left 1071857967 10:89645056-89645078 CCGACTCCCCCACCTCCTCTGCG 0: 1
1: 0
2: 3
3: 60
4: 796
Right 1071857983 10:89645090-89645112 GCGCGCCGGCCCCACGGCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 209
1071857965_1071857983 18 Left 1071857965 10:89645049-89645071 CCTCCTGCCGACTCCCCCACCTC 0: 1
1: 0
2: 10
3: 100
4: 880
Right 1071857983 10:89645090-89645112 GCGCGCCGGCCCCACGGCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 209
1071857964_1071857983 21 Left 1071857964 10:89645046-89645068 CCTCCTCCTGCCGACTCCCCCAC 0: 1
1: 1
2: 1
3: 86
4: 830
Right 1071857983 10:89645090-89645112 GCGCGCCGGCCCCACGGCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 209
1071857962_1071857983 23 Left 1071857962 10:89645044-89645066 CCCCTCCTCCTGCCGACTCCCCC 0: 1
1: 1
2: 3
3: 93
4: 992
Right 1071857983 10:89645090-89645112 GCGCGCCGGCCCCACGGCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 209
1071857961_1071857983 26 Left 1071857961 10:89645041-89645063 CCTCCCCTCCTCCTGCCGACTCC 0: 1
1: 0
2: 3
3: 124
4: 1001
Right 1071857983 10:89645090-89645112 GCGCGCCGGCCCCACGGCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071857983 Original CRISPR GCGCGCCGGCCCCACGGCGC CGG Exonic