ID: 1071858011

View in Genome Browser
Species Human (GRCh38)
Location 10:89645166-89645188
Sequence AAGGCGGGCGGCGGGAGCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 1, 2: 4, 3: 32, 4: 370}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071858011_1071858016 -8 Left 1071858011 10:89645166-89645188 CCGGGGCTCCCGCCGCCCGCCTT 0: 1
1: 1
2: 4
3: 32
4: 370
Right 1071858016 10:89645181-89645203 CCCGCCTTCCCCTGATCCCCAGG 0: 1
1: 0
2: 0
3: 39
4: 363
1071858011_1071858025 12 Left 1071858011 10:89645166-89645188 CCGGGGCTCCCGCCGCCCGCCTT 0: 1
1: 1
2: 4
3: 32
4: 370
Right 1071858025 10:89645201-89645223 AGGCCGCGCGACTTCAAACGCGG 0: 1
1: 0
2: 0
3: 0
4: 10

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071858011 Original CRISPR AAGGCGGGCGGCGGGAGCCC CGG (reversed) Exonic