ID: 1071867307

View in Genome Browser
Species Human (GRCh38)
Location 10:89748703-89748725
Sequence ACATTCACCAAGAGGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071867307_1071867312 15 Left 1071867307 10:89748703-89748725 CCTTTGTCCCTCTTGGTGAATGT 0: 1
1: 0
2: 2
3: 22
4: 245
Right 1071867312 10:89748741-89748763 ACTCTGGAAAAGTCTACCCTTGG No data
1071867307_1071867313 21 Left 1071867307 10:89748703-89748725 CCTTTGTCCCTCTTGGTGAATGT 0: 1
1: 0
2: 2
3: 22
4: 245
Right 1071867313 10:89748747-89748769 GAAAAGTCTACCCTTGGACCAGG No data
1071867307_1071867311 -1 Left 1071867307 10:89748703-89748725 CCTTTGTCCCTCTTGGTGAATGT 0: 1
1: 0
2: 2
3: 22
4: 245
Right 1071867311 10:89748725-89748747 TGGACACATCTTAGATACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071867307 Original CRISPR ACATTCACCAAGAGGGACAA AGG (reversed) Intronic
900463853 1:2814416-2814438 ACACTCACCACGAGGGTCCACGG + Intergenic
904238705 1:29130294-29130316 ACACTCACCACGAGGGTCCACGG - Intergenic
904797954 1:33071579-33071601 ACATACACAAAGAGGGAGAAAGG + Intronic
905825480 1:41023259-41023281 ACATCCAGCAAGAGGGTTAACGG - Intergenic
906358117 1:45126279-45126301 ACCTTCAGCAAGAATGACAAAGG + Intronic
907108506 1:51905650-51905672 AGATTCAGACAGAGGGACAAAGG - Intergenic
909706488 1:78591075-78591097 GCATGCAACAAGATGGACAATGG + Intergenic
912735481 1:112146228-112146250 ACATTCCCTTAGAGGGACCAAGG + Intergenic
912782777 1:112568293-112568315 ACATTAATCAAGAGTGTCAATGG + Intronic
912956915 1:114160860-114160882 ACATACAACAAGGCGGACAAGGG - Intergenic
913178496 1:116297250-116297272 ACACTCACCACGAGGGTCAGCGG - Intergenic
913225886 1:116697868-116697890 ACATCCACCAAGACCGACAGTGG + Intronic
913241371 1:116832892-116832914 ACATCCACCAGGATGGAGAAGGG - Intergenic
919083686 1:192895253-192895275 ACACTCACCACGAGGGTCCATGG - Intergenic
919920138 1:202162475-202162497 ACATCCACCCAGAGGGAACAGGG - Intergenic
920183769 1:204148157-204148179 ACCTTCACCCAGAGGGATGATGG + Intronic
920863312 1:209729579-209729601 TCAGACACCAAGAAGGACAAAGG + Intronic
921020353 1:211229428-211229450 ACACTCACCACGAGGGTCCATGG + Intergenic
922212274 1:223495451-223495473 CCATTCACTGAAAGGGACAAAGG - Intergenic
922772301 1:228192466-228192488 AAAATCAGCAAGAAGGACAAGGG - Intergenic
922873940 1:228925301-228925323 ACATGCACTAAGAGGCAAAATGG + Intergenic
1064184676 10:13151114-13151136 AGATCCACCAAGAAGAACAATGG - Intergenic
1064826331 10:19406740-19406762 ACATTCACCATGTGTGAGAACGG - Intronic
1068589805 10:58841880-58841902 ACATACACCATGGGGGACAGTGG + Intergenic
1069134398 10:64746054-64746076 ACAATCAGCAAAAAGGACAATGG - Intergenic
1070400321 10:76047456-76047478 ACCTCAACCAAGAGAGACAATGG - Intronic
1070468173 10:76746764-76746786 ACACATACCAAGAGGGAAAAAGG + Intergenic
1071316211 10:84401302-84401324 ACATTTAGCAAGACTGACAAAGG + Intronic
1071867307 10:89748703-89748725 ACATTCACCAAGAGGGACAAAGG - Intronic
1072284027 10:93895404-93895426 ACATTCACCCAGAGGGTGATAGG - Intronic
1076483293 10:130799132-130799154 ACATTCACCAGGATAGAAAAAGG + Intergenic
1077155498 11:1089177-1089199 ATATTCACCCGGAGGGAGAAAGG + Intergenic
1078864688 11:15286452-15286474 ACAGTTACCAAGAGGACCAAGGG - Intergenic
1079730410 11:23933978-23934000 ACACTCACCACGAGGGTCCATGG - Intergenic
1080805435 11:35648773-35648795 AGATTCAAGAAGAGGGAGAAAGG - Intergenic
1081135993 11:39441291-39441313 ACACTCACCACGAGGGTCCACGG - Intergenic
1081145716 11:39561167-39561189 ACACTCACCAAGAGGGTCCATGG + Intergenic
1082692335 11:56321702-56321724 ACAATCACCATGTGGTACAATGG - Intergenic
1086642797 11:89180509-89180531 ACATTCATGAAGAGAGAAAAAGG - Intronic
1087437197 11:98136278-98136300 ACATTCACCATGAAGGTCCACGG + Intergenic
1087865190 11:103217058-103217080 ACAGTTACCAAGAGGGAGATGGG - Intronic
1087960299 11:104339920-104339942 ACACTCACCACGAGGGTCCATGG + Intergenic
1088492256 11:110399872-110399894 ACACTCACCACGAGGGTCCAAGG + Intergenic
1089032145 11:115342979-115343001 ACATTCATGAAGAGATACAAGGG + Intronic
1089099106 11:115945923-115945945 GCATTCATCAGGAGGGTCAAAGG + Intergenic
1092646643 12:10581534-10581556 ACACTCACCACGAGGGTCCATGG + Intergenic
1093131341 12:15394987-15395009 ACACTCAGCAAAAGGGACAGAGG + Intronic
1093434519 12:19121252-19121274 ACATTCACTAAGAGGGTAAATGG + Intergenic
1094419113 12:30251959-30251981 ACATTCCCCAAGACAAACAATGG + Intergenic
1095827794 12:46548311-46548333 AGATTGAGAAAGAGGGACAAGGG - Intergenic
1097156284 12:57014556-57014578 TCATTGACCAAGAGGGGCAGAGG + Intronic
1099116722 12:78635732-78635754 ACATTGACTAAGAGTGTCAATGG - Intergenic
1099690587 12:85946829-85946851 ACACTCACCACGAGGGTCAGTGG + Intergenic
1099849969 12:88081214-88081236 AATGTCCCCAAGAGGGACAATGG + Intronic
1101704579 12:107210188-107210210 ACACTCACCAAGAGGGTCTGCGG + Intergenic
1102579230 12:113875571-113875593 ACATACACCAAGATGTCCAAGGG - Intronic
1102622412 12:114206682-114206704 ACATTGACCTAGTGGGAGAAAGG - Intergenic
1102990104 12:117309283-117309305 ACATTCAGCTAGTGGGACCATGG + Intronic
1104344197 12:127981097-127981119 GTATTAACCAAGAGTGACAAAGG - Intergenic
1105934892 13:25089745-25089767 TCATACACAAAGAGGGAAAAGGG - Intergenic
1106588992 13:31082420-31082442 AGATTCACCAAGGGGAAAAAAGG + Intergenic
1107140046 13:36988713-36988735 ACATTCAACAGGAAGGAGAAGGG - Intronic
1110242630 13:73285893-73285915 CCAGTCACCAAGAGAGGCAAAGG - Intergenic
1110405848 13:75149700-75149722 AAATTTATCAAGATGGACAATGG - Intergenic
1111965899 13:94861324-94861346 ACAAGCTCCAAGAGGGACACAGG - Intergenic
1112226716 13:97546678-97546700 ACATTCACCGCGAGGGTCCACGG + Intergenic
1114625031 14:24123368-24123390 ACATTCCCCACAAGGGAGAAAGG - Exonic
1116487849 14:45472738-45472760 AAATTCAGCAATAGGAACAACGG + Intergenic
1117921006 14:60724737-60724759 ACATCCAAAAAGAGGGAGAATGG - Intergenic
1118727870 14:68643010-68643032 ACATTCACCAAGACAGACCATGG - Intronic
1120028508 14:79613082-79613104 ACAGGCAGCAAGAAGGACAAAGG - Intronic
1120816613 14:88866529-88866551 ACTTTCACAGAGAGGGTCAATGG - Intronic
1121413105 14:93761447-93761469 ACAGTGACCACGAGGGACAGTGG - Intronic
1127361695 15:58249880-58249902 ACATTTATAAAGAGAGACAATGG + Intronic
1128902770 15:71440106-71440128 ACATTCACCCAAATGGACTAAGG + Intronic
1129835189 15:78700029-78700051 ACCTTCACCAAAAGGAAGAAAGG - Intronic
1130119128 15:81031711-81031733 ACAATCAACAAGAGGGAAATTGG - Intronic
1131720450 15:95162734-95162756 ACATTCAGCCAAAGGGACCATGG - Intergenic
1132350185 15:101134515-101134537 ATATTGACCAAAAGGGACATGGG - Intergenic
1132869071 16:2107564-2107586 ACATCCAGCAACAGGGACATGGG + Intronic
1132888200 16:2191697-2191719 CCACTAACCAAGAGGGACACTGG - Intronic
1133215913 16:4292458-4292480 CCAGTCACCCAGAGGGACACTGG - Intergenic
1133871145 16:9687561-9687583 TCATTCACTAGAAGGGACAAGGG - Intergenic
1134550125 16:15134961-15134983 ACATCCAGCAACAGGGACATGGG + Intronic
1134718344 16:16368034-16368056 ACATCCAGCAACAGGGACATGGG - Intergenic
1134956408 16:18384125-18384147 ACATCCAGCAACAGGGACATGGG + Intergenic
1135186370 16:20319299-20319321 TCATTCACCTTGAGGAACAAAGG - Intronic
1139083682 16:63559023-63559045 CTATTTACCAAGAGTGACAATGG - Intergenic
1140264073 16:73405294-73405316 ACATCTACCAAGAAGGACTAAGG + Intergenic
1141008090 16:80371952-80371974 GCATTCCCCAAGATGGTCAAAGG - Intergenic
1141855798 16:86680895-86680917 ACATCCACTGAGAGGGACAAGGG + Intergenic
1141936361 16:87241409-87241431 AGATTTTCCTAGAGGGACAAGGG + Intronic
1142987117 17:3702716-3702738 ACACTCACCACGAGGGTCCATGG + Intergenic
1143179426 17:4974875-4974897 ACCTTCACCATGGGGGACAAAGG - Intronic
1146551870 17:33787369-33787391 ACATTCCCCAGGAGGGAAGATGG + Intronic
1146587191 17:34092441-34092463 ACATTGGACATGAGGGACAAGGG - Intronic
1149423434 17:56532437-56532459 ACAGTCAACAAGCTGGACAAAGG + Intergenic
1150621157 17:66808629-66808651 ACAGTCACCAGGAAGGACAAGGG + Exonic
1151058436 17:71061188-71061210 ACTTTAACCATGTGGGACAATGG - Intergenic
1152149078 17:78587820-78587842 AGATTCACCAAGCCAGACAAAGG + Intergenic
1203162779 17_GL000205v2_random:66295-66317 ACATTCTACCAGAGGTACAAAGG - Intergenic
1153469342 18:5426298-5426320 ACATTCGGCAGGAGGGAAAAGGG - Intronic
1154173765 18:12068396-12068418 ACGTACGCCAAGAGGGGCAAGGG - Intergenic
1155393251 18:25359716-25359738 ACATTCACCAAAAGGCAGACAGG - Intergenic
1155958872 18:31977219-31977241 ACATTAACAAAGAGGTAAAATGG + Intergenic
1156296731 18:35798652-35798674 ACATTCTGCATCAGGGACAAAGG + Intergenic
1156457965 18:37305309-37305331 ACATTTGCTAAGAGGGACAAAGG - Intronic
1156471467 18:37379690-37379712 AAATGCACCAAGAGGAATAAAGG + Intronic
1156632729 18:38989601-38989623 ACATTTACAAAGTGGGACATGGG - Intergenic
1157865064 18:51175651-51175673 ACATTCACCAAGAGAGGCAATGG + Exonic
1159443826 18:68514722-68514744 ACAGTAGCCAAGAGTGACAAAGG + Intergenic
1160412168 18:78682512-78682534 ACACTCACCAAGAGGGAGAGTGG - Intergenic
1162090923 19:8279554-8279576 ACATTCACCACGAGGGTCTGTGG - Intronic
1164582129 19:29441247-29441269 ACACTCACCACGAGGGTCCATGG + Intergenic
1164746565 19:30620469-30620491 ACATTCACCCAGATGGGGAATGG + Intronic
1164989286 19:32673107-32673129 ACAGTCACAAAGAGGCACAACGG + Intronic
1165788180 19:38474853-38474875 ACATCCACCAAGAGACACAATGG - Intronic
1166728822 19:45046062-45046084 ACGTTCACATACAGGGACAAAGG - Intronic
1168579172 19:57539395-57539417 ACATTACCCAAGAGGGAAATGGG + Exonic
925320541 2:2963229-2963251 ACATTAGGCAAGAGGGAGAAGGG + Intergenic
929178948 2:39011942-39011964 AAATTCAGCTAGAGGGACCAGGG + Intronic
931158563 2:59663190-59663212 ACACACACAAAGTGGGACAAAGG + Intergenic
931840996 2:66148067-66148089 ATATTTTCCTAGAGGGACAAGGG - Intergenic
933390519 2:81660950-81660972 ACAATCACCAAGAGCAACAATGG + Intergenic
936373280 2:111920460-111920482 ACATTCTCCAAGTGGCCCAAGGG + Intronic
936709406 2:115114628-115114650 ACTTTCTCCTAGAGAGACAAAGG - Intronic
937097488 2:119245238-119245260 TCATTCAGCAGGAGGGACAAAGG + Intronic
937873618 2:126804017-126804039 ACACCCTGCAAGAGGGACAAGGG - Intergenic
939053004 2:137330441-137330463 ACACTCACCATGAGGGTCCACGG - Intronic
939792364 2:146593766-146593788 AAAGTCACCAAGAAAGACAAAGG + Intergenic
941272742 2:163450884-163450906 ACACTCACCACGAGGGTCCATGG + Intergenic
943708695 2:191064337-191064359 ACAGTCACCATGATGTACAATGG + Intronic
944979462 2:205098714-205098736 CCAGGCACCAAGAGGGGCAACGG - Intronic
947279340 2:228431752-228431774 ACTTTCATCAAGAAGGAGAAGGG - Intergenic
947509450 2:230737712-230737734 CCATTCAGGAAGAGGTACAATGG - Intronic
947685030 2:232076144-232076166 ATATACAACAAGAGGGAGAAAGG - Intronic
948008327 2:234629447-234629469 ACATTCTGCAAGGGGGACCAGGG + Intergenic
1169454833 20:5743352-5743374 ATTTTCACCAACAGGTACAAGGG + Intergenic
1169655607 20:7919447-7919469 ACAATCACTAAAAGGGACACTGG + Intronic
1169953167 20:11070880-11070902 CCATTCAGCTAGAGGCACAAGGG - Intergenic
1170377952 20:15722552-15722574 ACAGTCAACAAGGGGGAAAATGG - Intronic
1170546711 20:17440877-17440899 AAATGCACCAAGAGGGATCAGGG + Intronic
1171270344 20:23812198-23812220 ACACTCACCATGAGGGTCCACGG + Intergenic
1174838044 20:53876628-53876650 ACAATGACCAAGAGGGAGGAGGG - Intergenic
1177169955 21:17644202-17644224 AGATTCTCCAAGAAAGACAATGG + Intergenic
1177243235 21:18489148-18489170 ACAATCAGCAACTGGGACAAAGG + Intergenic
1178082075 21:29076437-29076459 ACACTCACCACGAGGGTCCACGG - Intergenic
1179816859 21:43911915-43911937 ACATTCACCAAGAGGTAAGGGGG - Intronic
1182599319 22:31448093-31448115 CCATGCACCAAGAGGGTGAAGGG + Intronic
1185397254 22:50599358-50599380 ACTTTCATCAAGGGGGAAAAGGG + Intronic
949207345 3:1455695-1455717 ACACTCACCACGAGGGTCCACGG + Intergenic
950496840 3:13338898-13338920 AAATTCAGCAAGAGGGGCACAGG - Intronic
952757470 3:36884323-36884345 ACATTCTCCAATAGGAACCAGGG + Intronic
955755471 3:62220973-62220995 ACAGTGACCAAGAAGGACCATGG + Intronic
958949008 3:100397454-100397476 ATATTCCACAAGATGGACAATGG + Intronic
961403793 3:126665201-126665223 AAATTCAGCCAGAGGGACACAGG + Intergenic
962285031 3:134078118-134078140 ACATTCTCCCAGAGGGATAATGG + Intronic
962998317 3:140652721-140652743 ACACTCACCACGAGGGTCCACGG + Intergenic
963688653 3:148470845-148470867 AAATTCACCAAGTGGGCCATGGG + Intergenic
964103552 3:153016079-153016101 ACTTTCACCAGGAGGAAAAAGGG - Intergenic
965256922 3:166424845-166424867 ACACTCACCACGAGGGTCCACGG + Intergenic
966217755 3:177520291-177520313 ACACCCTGCAAGAGGGACAAGGG + Intergenic
967734551 3:192938530-192938552 ACACTCACCACGAGGGTCCACGG - Intergenic
968056267 3:195694267-195694289 ATAATCCCCAAAAGGGACAAGGG - Intergenic
969017873 4:4116544-4116566 ACACTCACCAGGAGGGTCCACGG + Intergenic
970552301 4:17194478-17194500 AGATTAACCAACAGGGACTATGG - Intergenic
970803689 4:20004981-20005003 ACATTCACCACGAGGGTCCGCGG + Intergenic
971787195 4:31119863-31119885 ACACGCACTAAGAGGGAAAATGG - Intronic
972304383 4:37818148-37818170 ACAGTCAACAAGAGAGTCAATGG + Intergenic
976508861 4:85883596-85883618 ACATAAACAAAGAGGGCCAATGG + Intronic
978747505 4:112210457-112210479 ACACTCACCATGAGGGTCCACGG + Intergenic
980222986 4:129944536-129944558 ACATTCTACAAGAGGTACAAAGG - Intergenic
980739417 4:136930174-136930196 ACACTCACCACGAGGGTCCACGG + Intergenic
981281841 4:142967353-142967375 ACACCCACCAAAAGGAACAAGGG + Intergenic
982424132 4:155236942-155236964 ACACTCACCAAGAGGGACTGCGG - Intergenic
983014789 4:162599954-162599976 ACATTCACCACGAGGGCCGGGGG - Intergenic
984479068 4:180275694-180275716 AGAATCACAAAGAGGGACACAGG + Intergenic
984632514 4:182075715-182075737 AAATTCACCAAGAAGGCCATGGG - Intergenic
985025889 4:185738696-185738718 ACATTCCCCAAGTGGGTCTAAGG + Intronic
987476501 5:18398844-18398866 ACACTCACCACGAGGGTCCATGG - Intergenic
987987632 5:25169173-25169195 ATAATCACCATGAGGTACAATGG - Intergenic
989401265 5:41010115-41010137 TCATTCACATAGAGGGAAAATGG - Intronic
990876953 5:60496698-60496720 ATTTTCACCAAGAGTGAGAAAGG + Intronic
992146175 5:73851556-73851578 AGTCTCACCAAGGGGGACAAAGG + Intronic
994336164 5:98568775-98568797 ACACTCACCATGAGGGAAGATGG + Intergenic
994754474 5:103778014-103778036 ACATTCACCATGAGGGTCTGCGG - Intergenic
1000682637 5:164204932-164204954 ACATTCACATAGATGGACACAGG + Intergenic
1001001480 5:168011619-168011641 AGAATCACCAAGAGGAACGAGGG - Intronic
1002766687 6:246555-246577 ACCTTCACCATGATGGACATGGG - Intergenic
1004127444 6:12887252-12887274 ACATGCACCAAAAGGAAGAATGG + Intronic
1004586439 6:17006113-17006135 ACACTCACCAGGAGGGTCCACGG - Intergenic
1004945091 6:20603627-20603649 AGACTCACCATGAAGGACAATGG + Intronic
1006059894 6:31411943-31411965 ACATTCACCATGGGGGGCACTGG - Exonic
1006072384 6:31507018-31507040 ACATTCACCATGGGGGGCACTGG - Exonic
1006221262 6:32494049-32494071 ACACTCACCACGAGGGTCCATGG + Intergenic
1006561696 6:34918386-34918408 ACAGTCACCATGAGGGTCAAAGG + Intronic
1009268073 6:61580840-61580862 ACACTCACCAAGAGGGTCCATGG + Intergenic
1010769009 6:79807206-79807228 ACACTCACCACGAGGGTCCAAGG + Intergenic
1011166624 6:84454870-84454892 ACATTTTAAAAGAGGGACAAAGG + Intergenic
1011639087 6:89402525-89402547 ACATTAGGCATGAGGGACAAGGG + Intronic
1012131473 6:95498368-95498390 ACACTCACCATGAGGGTCCACGG + Intergenic
1012895612 6:104942631-104942653 ACCTTCCCTAAGATGGACAAGGG - Intergenic
1013957427 6:115856546-115856568 ACACTCACCACGAGGGTCCATGG + Intergenic
1015210805 6:130696113-130696135 ACACTTACCAAGTAGGACAATGG - Intergenic
1015875558 6:137818495-137818517 AAATACACCAAGAGGGAGAGAGG - Intergenic
1016144956 6:140658977-140658999 ACCTTCACCAAGAAGGAGGATGG + Intergenic
1016172756 6:141040425-141040447 ACACTCACCATGAGGGTCCACGG - Intergenic
1016858744 6:148697229-148697251 ACACTCACCATGAGGGTCCATGG - Intergenic
1017396412 6:154004469-154004491 ACATTCACCAAGAGGAAGATAGG + Intergenic
1019546904 7:1582268-1582290 ACAGTCAGGAAGATGGACAATGG - Intergenic
1019618180 7:1976255-1976277 ACACTCACCATGAGGGTCCACGG - Intronic
1020521427 7:9192647-9192669 ACATGCAGCAACATGGACAAAGG - Intergenic
1021039575 7:15845282-15845304 ACATTCACCAACAGAGACCGAGG + Intergenic
1022258735 7:28684043-28684065 ATATTAACCAAGATGGTCAATGG + Intronic
1022839663 7:34151056-34151078 ACATTCACCAAGCTAGATAATGG + Intronic
1023546025 7:41318257-41318279 ACACTCACCACGAGGGTCCACGG - Intergenic
1026111999 7:67465795-67465817 ACATTAACAAAGAGGGAATACGG - Intergenic
1026486112 7:70822922-70822944 ACACTCACCAAGAGGGTCTGTGG + Intergenic
1027429503 7:78095657-78095679 CCATTCTCCATGAGGGAAAAAGG - Intronic
1027790788 7:82637492-82637514 ACACTCACCACGAGGGTCCACGG + Intergenic
1028392834 7:90335536-90335558 ACACTCACCACGAGGGTCCAAGG + Intronic
1028503594 7:91546934-91546956 ACATTCAGAAAGAGGAAGAATGG - Intergenic
1030101977 7:105955095-105955117 ACACTCACCACGAGGGTCCACGG - Intronic
1031401068 7:121327061-121327083 AGCTTCTCCAAGAGGGACAATGG - Intronic
1035132175 7:156665532-156665554 ACGTTCACCAACAGTGAGAATGG - Intronic
1035417155 7:158699285-158699307 TGATTCTCCAAGAAGGACAAGGG + Intronic
1036203043 8:6785137-6785159 ACATGCAGGAAGAGGAACAAAGG - Intergenic
1037384416 8:18322281-18322303 ATAGTCACCAAGATGTACAATGG + Intergenic
1037676510 8:21055732-21055754 ACAGTGACCAAAAGGGACAAGGG - Intergenic
1037990795 8:23320074-23320096 ACGGTCACCAAGAGGGACAAGGG + Intronic
1038524941 8:28264537-28264559 ACATTCACCACGAAGGTCCATGG + Intergenic
1038671847 8:29589289-29589311 ACATGCACCCAGAGGCAAAAGGG - Intergenic
1040649918 8:49435780-49435802 ACACTCACCATGAGGGTCCACGG + Intergenic
1042290517 8:67166218-67166240 ACATTCTCCAAAAGGAACCAGGG - Intronic
1043111638 8:76191232-76191254 ACATTTAACAAGTTGGACAAAGG - Intergenic
1043224187 8:77701759-77701781 ACACTCACCATGAGGGTCCACGG + Intergenic
1044003163 8:86910306-86910328 ACAATCACCAAGAGGGAATTGGG - Intronic
1044934944 8:97284905-97284927 ATATTCAAGAAGAAGGACAAAGG + Intergenic
1045743168 8:105386437-105386459 ACACTCACCACGAGGGTCCACGG - Intronic
1046127491 8:109928470-109928492 ACAGTCAGCAAAAAGGACAATGG - Intergenic
1046740242 8:117820037-117820059 AACATCACCAAGAGGGGCAAAGG - Intronic
1046860675 8:119087749-119087771 ACCTAGACCAAAAGGGACAACGG + Intronic
1046946245 8:119976811-119976833 AGATTCACCAAGTGGGAGAATGG + Intronic
1053280038 9:36814545-36814567 ACTGTTTCCAAGAGGGACAAAGG - Intergenic
1056028313 9:82524416-82524438 TCATTGGTCAAGAGGGACAATGG + Intergenic
1056391784 9:86147489-86147511 ACACTCACCACGAGGGTCCACGG - Intergenic
1060076747 9:120597663-120597685 ACAGTCACTAAGAGGGATTAGGG - Intergenic
1187005671 X:15230800-15230822 ACATTCACCGTGAGGGTCCACGG - Intergenic
1188848072 X:35098827-35098849 ACATTCATAAAGAGGAAGAAGGG - Intergenic
1189952136 X:46243853-46243875 ACACTCTCCAAGAGGGTCCATGG - Intergenic
1190681447 X:52830220-52830242 GCATTCACCACGAGGGCGAAGGG + Intergenic
1190685328 X:52868078-52868100 GCATTCACCACGTGGGAAAAGGG + Intergenic
1193125625 X:77867307-77867329 ACAATAACAAAGAGGGCCAATGG - Intronic
1194068209 X:89288036-89288058 ACACCCTGCAAGAGGGACAAGGG - Intergenic
1194117963 X:89926251-89926273 ACACTCACCACGAGGGTCCACGG - Intergenic
1195599772 X:106732875-106732897 ACATTCACCAACATGTTCAATGG - Intronic
1196696676 X:118620615-118620637 ACATTCACAAAAAGTGAAAATGG - Intronic
1196845226 X:119891770-119891792 ACACTCACCAAGAGGGTCCGCGG + Intergenic
1197069234 X:122273971-122273993 TCATTCACCAAGGGGAAAAATGG + Intergenic
1197634934 X:128904148-128904170 AAACTCACCAGCAGGGACAAGGG + Intergenic
1198306998 X:135393363-135393385 ACCATCACACAGAGGGACAACGG - Intergenic
1198374294 X:136022622-136022644 AAATTAAGTAAGAGGGACAAGGG - Exonic
1198458000 X:136836414-136836436 ACATTCACTGAAAAGGACAACGG - Intergenic
1198674382 X:139116788-139116810 ACATACAGCAGGAGGGAGAATGG + Intronic
1199437340 X:147827754-147827776 ACACTCACCACGAGGGTCCACGG - Intergenic
1200040335 X:153361074-153361096 ATATTCACCAAGAAGGGGAAGGG - Intergenic
1200077554 X:153558936-153558958 ACACTCACCAATGGGGAAAATGG - Intronic
1200470735 Y:3583383-3583405 ACACTCACCACGAGGGTCCACGG - Intergenic
1200722351 Y:6622206-6622228 ACACCCTGCAAGAGGGACAAGGG - Intergenic
1201480109 Y:14429390-14429412 ACATTCACCGCGAGGGTCCACGG + Intergenic