ID: 1071868354

View in Genome Browser
Species Human (GRCh38)
Location 10:89763448-89763470
Sequence CTGTATTGGAAGAGAAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071868349_1071868354 1 Left 1071868349 10:89763424-89763446 CCTGTTCATACTTAGTCACTTTC No data
Right 1071868354 10:89763448-89763470 CTGTATTGGAAGAGAAAAGAGGG No data
1071868347_1071868354 19 Left 1071868347 10:89763406-89763428 CCATTTCAGTATACCAGTCCTGT No data
Right 1071868354 10:89763448-89763470 CTGTATTGGAAGAGAAAAGAGGG No data
1071868348_1071868354 6 Left 1071868348 10:89763419-89763441 CCAGTCCTGTTCATACTTAGTCA No data
Right 1071868354 10:89763448-89763470 CTGTATTGGAAGAGAAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071868354 Original CRISPR CTGTATTGGAAGAGAAAAGA GGG Intronic
No off target data available for this crispr