ID: 1071868354

View in Genome Browser
Species Human (GRCh38)
Location 10:89763448-89763470
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071868348_1071868354 6 Left 1071868348 10:89763419-89763441 CCAGTCCTGTTCATACTTAGTCA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1071868354 10:89763448-89763470 CTGTATTGGAAGAGAAAAGAGGG No data
1071868349_1071868354 1 Left 1071868349 10:89763424-89763446 CCTGTTCATACTTAGTCACTTTC 0: 1
1: 0
2: 0
3: 8
4: 134
Right 1071868354 10:89763448-89763470 CTGTATTGGAAGAGAAAAGAGGG No data
1071868347_1071868354 19 Left 1071868347 10:89763406-89763428 CCATTTCAGTATACCAGTCCTGT 0: 1
1: 0
2: 2
3: 8
4: 110
Right 1071868354 10:89763448-89763470 CTGTATTGGAAGAGAAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr