ID: 1071873124

View in Genome Browser
Species Human (GRCh38)
Location 10:89816719-89816741
Sequence CAGTAGGACAGGGGAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071873124_1071873131 -9 Left 1071873124 10:89816719-89816741 CCATCTTCTCCCCTGTCCTACTG No data
Right 1071873131 10:89816733-89816755 GTCCTACTGCTGGAGGGCCCTGG No data
1071873124_1071873134 4 Left 1071873124 10:89816719-89816741 CCATCTTCTCCCCTGTCCTACTG No data
Right 1071873134 10:89816746-89816768 AGGGCCCTGGGCCCTGTCCTTGG No data
1071873124_1071873132 -8 Left 1071873124 10:89816719-89816741 CCATCTTCTCCCCTGTCCTACTG No data
Right 1071873132 10:89816734-89816756 TCCTACTGCTGGAGGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071873124 Original CRISPR CAGTAGGACAGGGGAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr