ID: 1071875343

View in Genome Browser
Species Human (GRCh38)
Location 10:89837831-89837853
Sequence CCGCGCGTACCTTGTCCCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10
Summary {0: 1, 1: 1, 2: 0, 3: 0, 4: 8}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071875334_1071875343 14 Left 1071875334 10:89837794-89837816 CCGCATTTCCGGGGCCGTCACCT 0: 1
1: 1
2: 0
3: 7
4: 63
Right 1071875343 10:89837831-89837853 CCGCGCGTACCTTGTCCCATCGG 0: 1
1: 1
2: 0
3: 0
4: 8
1071875337_1071875343 6 Left 1071875337 10:89837802-89837824 CCGGGGCCGTCACCTGTCGGGCT 0: 1
1: 0
2: 1
3: 6
4: 99
Right 1071875343 10:89837831-89837853 CCGCGCGTACCTTGTCCCATCGG 0: 1
1: 1
2: 0
3: 0
4: 8
1071875340_1071875343 -6 Left 1071875340 10:89837814-89837836 CCTGTCGGGCTGCCAGGCCGCGC 0: 1
1: 0
2: 2
3: 13
4: 130
Right 1071875343 10:89837831-89837853 CCGCGCGTACCTTGTCCCATCGG 0: 1
1: 1
2: 0
3: 0
4: 8
1071875332_1071875343 23 Left 1071875332 10:89837785-89837807 CCGGTTGGGCCGCATTTCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1071875343 10:89837831-89837853 CCGCGCGTACCTTGTCCCATCGG 0: 1
1: 1
2: 0
3: 0
4: 8
1071875338_1071875343 0 Left 1071875338 10:89837808-89837830 CCGTCACCTGTCGGGCTGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1071875343 10:89837831-89837853 CCGCGCGTACCTTGTCCCATCGG 0: 1
1: 1
2: 0
3: 0
4: 8
1071875330_1071875343 24 Left 1071875330 10:89837784-89837806 CCCGGTTGGGCCGCATTTCCGGG 0: 1
1: 0
2: 1
3: 4
4: 43
Right 1071875343 10:89837831-89837853 CCGCGCGTACCTTGTCCCATCGG 0: 1
1: 1
2: 0
3: 0
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071875343 Original CRISPR CCGCGCGTACCTTGTCCCAT CGG Intergenic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
924250115 1:242124128-242124150 CCGCTCTTAGCATGTCCCATCGG + Intronic
1065150986 10:22823188-22823210 CAGCTTGTACTTTGTCCCATTGG + Intergenic
1071875343 10:89837831-89837853 CCGCGCGTACCTTGTCCCATCGG + Intergenic
1072122964 10:92420191-92420213 CCGCGCGTACCTGGTCCCATCGG - Intergenic
1124925637 15:34067707-34067729 CCCCACCTCCCTTGTCCCATAGG - Intergenic
941250734 2:163158689-163158711 ACCCCCATACCTTGTCCCATTGG + Intergenic
1022792151 7:33699819-33699841 GCATGAGTACCTTGTCCCATGGG + Intergenic
1057040589 9:91844861-91844883 CCCCGCCTTCCCTGTCCCATGGG - Intronic
1186669860 X:11757935-11757957 CCGCGGGGACCCTCTCCCATGGG + Intergenic