ID: 1071876917

View in Genome Browser
Species Human (GRCh38)
Location 10:89852374-89852396
Sequence GTGCCTAGGACCCACTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071876917_1071876924 7 Left 1071876917 10:89852374-89852396 CCAGCCCAGTGGGTCCTAGGCAC No data
Right 1071876924 10:89852404-89852426 GACCTAGTGAAGCCCAAGGAAGG No data
1071876917_1071876923 3 Left 1071876917 10:89852374-89852396 CCAGCCCAGTGGGTCCTAGGCAC No data
Right 1071876923 10:89852400-89852422 TAGGGACCTAGTGAAGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071876917 Original CRISPR GTGCCTAGGACCCACTGGGC TGG (reversed) Intergenic
No off target data available for this crispr