ID: 1071876923

View in Genome Browser
Species Human (GRCh38)
Location 10:89852400-89852422
Sequence TAGGGACCTAGTGAAGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071876918_1071876923 -1 Left 1071876918 10:89852378-89852400 CCCAGTGGGTCCTAGGCACTTGT No data
Right 1071876923 10:89852400-89852422 TAGGGACCTAGTGAAGCCCAAGG No data
1071876919_1071876923 -2 Left 1071876919 10:89852379-89852401 CCAGTGGGTCCTAGGCACTTGTA No data
Right 1071876923 10:89852400-89852422 TAGGGACCTAGTGAAGCCCAAGG No data
1071876912_1071876923 26 Left 1071876912 10:89852351-89852373 CCCATGCTTATGTAAAGGCACTG No data
Right 1071876923 10:89852400-89852422 TAGGGACCTAGTGAAGCCCAAGG No data
1071876917_1071876923 3 Left 1071876917 10:89852374-89852396 CCAGCCCAGTGGGTCCTAGGCAC No data
Right 1071876923 10:89852400-89852422 TAGGGACCTAGTGAAGCCCAAGG No data
1071876913_1071876923 25 Left 1071876913 10:89852352-89852374 CCATGCTTATGTAAAGGCACTGC No data
Right 1071876923 10:89852400-89852422 TAGGGACCTAGTGAAGCCCAAGG No data
1071876911_1071876923 27 Left 1071876911 10:89852350-89852372 CCCCATGCTTATGTAAAGGCACT No data
Right 1071876923 10:89852400-89852422 TAGGGACCTAGTGAAGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071876923 Original CRISPR TAGGGACCTAGTGAAGCCCA AGG Intergenic
No off target data available for this crispr