ID: 1071876924

View in Genome Browser
Species Human (GRCh38)
Location 10:89852404-89852426
Sequence GACCTAGTGAAGCCCAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071876922_1071876924 -7 Left 1071876922 10:89852388-89852410 CCTAGGCACTTGTAGGGACCTAG No data
Right 1071876924 10:89852404-89852426 GACCTAGTGAAGCCCAAGGAAGG No data
1071876919_1071876924 2 Left 1071876919 10:89852379-89852401 CCAGTGGGTCCTAGGCACTTGTA No data
Right 1071876924 10:89852404-89852426 GACCTAGTGAAGCCCAAGGAAGG No data
1071876917_1071876924 7 Left 1071876917 10:89852374-89852396 CCAGCCCAGTGGGTCCTAGGCAC No data
Right 1071876924 10:89852404-89852426 GACCTAGTGAAGCCCAAGGAAGG No data
1071876918_1071876924 3 Left 1071876918 10:89852378-89852400 CCCAGTGGGTCCTAGGCACTTGT No data
Right 1071876924 10:89852404-89852426 GACCTAGTGAAGCCCAAGGAAGG No data
1071876912_1071876924 30 Left 1071876912 10:89852351-89852373 CCCATGCTTATGTAAAGGCACTG No data
Right 1071876924 10:89852404-89852426 GACCTAGTGAAGCCCAAGGAAGG No data
1071876913_1071876924 29 Left 1071876913 10:89852352-89852374 CCATGCTTATGTAAAGGCACTGC No data
Right 1071876924 10:89852404-89852426 GACCTAGTGAAGCCCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071876924 Original CRISPR GACCTAGTGAAGCCCAAGGA AGG Intergenic
No off target data available for this crispr