ID: 1071877298

View in Genome Browser
Species Human (GRCh38)
Location 10:89854815-89854837
Sequence CATGAACACTTACAACCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071877298_1071877301 -5 Left 1071877298 10:89854815-89854837 CCCCTGGGTTGTAAGTGTTCATG No data
Right 1071877301 10:89854833-89854855 TCATGCTATAAATTTATTATTGG No data
1071877298_1071877302 6 Left 1071877298 10:89854815-89854837 CCCCTGGGTTGTAAGTGTTCATG No data
Right 1071877302 10:89854844-89854866 ATTTATTATTGGATTCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071877298 Original CRISPR CATGAACACTTACAACCCAG GGG (reversed) Intergenic
No off target data available for this crispr