ID: 1071880099

View in Genome Browser
Species Human (GRCh38)
Location 10:89888062-89888084
Sequence CTGTGATGCTAGAGGCAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071880099_1071880104 3 Left 1071880099 10:89888062-89888084 CCGTCTTGCCTCTAGCATCACAG No data
Right 1071880104 10:89888088-89888110 GGCTGTCTCCGCTCATTCCTGGG No data
1071880099_1071880105 8 Left 1071880099 10:89888062-89888084 CCGTCTTGCCTCTAGCATCACAG No data
Right 1071880105 10:89888093-89888115 TCTCCGCTCATTCCTGGGCATGG No data
1071880099_1071880103 2 Left 1071880099 10:89888062-89888084 CCGTCTTGCCTCTAGCATCACAG No data
Right 1071880103 10:89888087-89888109 TGGCTGTCTCCGCTCATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071880099 Original CRISPR CTGTGATGCTAGAGGCAAGA CGG (reversed) Intergenic
No off target data available for this crispr