ID: 1071888667

View in Genome Browser
Species Human (GRCh38)
Location 10:89978583-89978605
Sequence ATTTGAAGATGCAGCCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071888667_1071888668 -1 Left 1071888667 10:89978583-89978605 CCTGGGCGGCTGCATCTTCAAAT No data
Right 1071888668 10:89978605-89978627 TCCAAAACATTTGAAAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071888667 Original CRISPR ATTTGAAGATGCAGCCGCCC AGG (reversed) Intergenic
No off target data available for this crispr