ID: 1071901690

View in Genome Browser
Species Human (GRCh38)
Location 10:90127394-90127416
Sequence ATGAGCTAGTAGAGGAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071901690_1071901695 13 Left 1071901690 10:90127394-90127416 CCTTCTCTCCTCTACTAGCTCAT No data
Right 1071901695 10:90127430-90127452 ATGAGAAGAGGATGTAGGCCTGG No data
1071901690_1071901692 1 Left 1071901690 10:90127394-90127416 CCTTCTCTCCTCTACTAGCTCAT No data
Right 1071901692 10:90127418-90127440 GCCACTAGAGAGATGAGAAGAGG No data
1071901690_1071901694 8 Left 1071901690 10:90127394-90127416 CCTTCTCTCCTCTACTAGCTCAT No data
Right 1071901694 10:90127425-90127447 GAGAGATGAGAAGAGGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071901690 Original CRISPR ATGAGCTAGTAGAGGAGAGA AGG (reversed) Intergenic
No off target data available for this crispr