ID: 1071907111

View in Genome Browser
Species Human (GRCh38)
Location 10:90186588-90186610
Sequence CTCTGTCTGGGCATGAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071907111_1071907114 -7 Left 1071907111 10:90186588-90186610 CCAAGATTCATGCCCAGACAGAG No data
Right 1071907114 10:90186604-90186626 GACAGAGCAGAGTAATTATTAGG No data
1071907111_1071907115 -3 Left 1071907111 10:90186588-90186610 CCAAGATTCATGCCCAGACAGAG No data
Right 1071907115 10:90186608-90186630 GAGCAGAGTAATTATTAGGATGG No data
1071907111_1071907116 -2 Left 1071907111 10:90186588-90186610 CCAAGATTCATGCCCAGACAGAG No data
Right 1071907116 10:90186609-90186631 AGCAGAGTAATTATTAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071907111 Original CRISPR CTCTGTCTGGGCATGAATCT TGG (reversed) Intergenic
No off target data available for this crispr