ID: 1071907926

View in Genome Browser
Species Human (GRCh38)
Location 10:90195625-90195647
Sequence GCGTGGGGCTCTAATTAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071907926_1071907932 -5 Left 1071907926 10:90195625-90195647 CCTTATTAATTAGAGCCCCACGC No data
Right 1071907932 10:90195643-90195665 CACGCTTTGTTCTGACTGGGTGG No data
1071907926_1071907929 -8 Left 1071907926 10:90195625-90195647 CCTTATTAATTAGAGCCCCACGC No data
Right 1071907929 10:90195640-90195662 CCCCACGCTTTGTTCTGACTGGG No data
1071907926_1071907927 -9 Left 1071907926 10:90195625-90195647 CCTTATTAATTAGAGCCCCACGC No data
Right 1071907927 10:90195639-90195661 GCCCCACGCTTTGTTCTGACTGG No data
1071907926_1071907933 -4 Left 1071907926 10:90195625-90195647 CCTTATTAATTAGAGCCCCACGC No data
Right 1071907933 10:90195644-90195666 ACGCTTTGTTCTGACTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071907926 Original CRISPR GCGTGGGGCTCTAATTAATA AGG (reversed) Intergenic
No off target data available for this crispr