ID: 1071907927

View in Genome Browser
Species Human (GRCh38)
Location 10:90195639-90195661
Sequence GCCCCACGCTTTGTTCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071907925_1071907927 21 Left 1071907925 10:90195595-90195617 CCACAGATGAACATTGATGGTGA No data
Right 1071907927 10:90195639-90195661 GCCCCACGCTTTGTTCTGACTGG No data
1071907926_1071907927 -9 Left 1071907926 10:90195625-90195647 CCTTATTAATTAGAGCCCCACGC No data
Right 1071907927 10:90195639-90195661 GCCCCACGCTTTGTTCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071907927 Original CRISPR GCCCCACGCTTTGTTCTGAC TGG Intergenic
No off target data available for this crispr